Incidental Mutation 'R7790:Grik3'
ID 599795
Institutional Source Beutler Lab
Gene Symbol Grik3
Ensembl Gene ENSMUSG00000001985
Gene Name glutamate receptor, ionotropic, kainate 3
Synonyms Glur7, Glur-7
MMRRC Submission 045846-MU
Accession Numbers
Essential gene? Probably non essential (E-score: 0.126) question?
Stock # R7790 (G1)
Quality Score 225.009
Status Validated
Chromosome 4
Chromosomal Location 125384493-125607966 bp(+) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) T to C at 125579812 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Leucine to Proline at position 519 (L519P)
Ref Sequence ENSEMBL: ENSMUSP00000030676 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000030676]
AlphaFold B1AS29
Predicted Effect probably damaging
Transcript: ENSMUST00000030676
AA Change: L519P

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000030676
Gene: ENSMUSG00000001985
AA Change: L519P

DomainStartEndE-ValueType
Pfam:ANF_receptor 55 398 7.8e-72 PFAM
PBPe 435 802 4.38e-133 SMART
Lig_chan-Glu_bd 445 509 5.77e-34 SMART
transmembrane domain 823 845 N/A INTRINSIC
Meta Mutation Damage Score 0.9077 question?
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.7%
  • 20x: 99.0%
Validation Efficiency 100% (81/81)
MGI Phenotype FUNCTION: Glutamate receptors are the predominant excitatory neurotransmitter receptors in the mammalian brain and are activated in a variety of normal neurophysiologic processes. This gene product belongs to the kainate family of glutamate receptors, which are composed of four subunits and function as ligand-activated ion channels. Transcript variants encoding different isoforms have been described for this gene, however, their full-length nature is not known. [provided by RefSeq, Jul 2008]
PHENOTYPE: Mice homozygous for a knock-out allele exhibit significantly reduced short- and long-term synaptic potentiation. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 83 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700009N14Rik A T 4: 39,451,201 (GRCm39) I136F possibly damaging Het
Abca13 A T 11: 9,247,915 (GRCm39) K2554M probably damaging Het
Ankrd12 C T 17: 66,291,225 (GRCm39) D1403N possibly damaging Het
Ankrd17 A G 5: 90,408,011 (GRCm39) V1402A possibly damaging Het
Ankrd36 A T 11: 5,585,176 (GRCm39) N329I possibly damaging Het
Atr A T 9: 95,756,233 (GRCm39) D815V probably damaging Het
C9orf72 T C 4: 35,192,997 (GRCm39) D444G unknown Het
Ceacam1 T C 7: 25,173,375 (GRCm39) Y271C probably damaging Het
Cenpo T C 12: 4,264,597 (GRCm39) H265R probably benign Het
Chd8 G A 14: 52,463,539 (GRCm39) R702W probably damaging Het
Ckap5 A G 2: 91,389,455 (GRCm39) N309S probably benign Het
Cxxc1 C T 18: 74,350,855 (GRCm39) R83C probably damaging Het
Dcaf6 T C 1: 165,227,284 (GRCm39) D281G probably damaging Het
Dennd4c A G 4: 86,717,754 (GRCm39) T584A probably damaging Het
Drgx T A 14: 32,350,845 (GRCm39) L227Q probably damaging Het
Dync2h1 G T 9: 7,114,914 (GRCm39) H2415N probably damaging Het
Dzip1l A G 9: 99,543,015 (GRCm39) E490G possibly damaging Het
Fam124a T C 14: 62,843,526 (GRCm39) S345P probably benign Het
Fam83b G A 9: 76,399,330 (GRCm39) T591I probably benign Het
Frem1 T C 4: 82,907,401 (GRCm39) S838G probably benign Het
Fsip2 G T 2: 82,818,723 (GRCm39) D4819Y probably benign Het
Gm43302 T G 5: 105,425,691 (GRCm39) K246T probably benign Het
Gml T C 15: 74,685,462 (GRCm39) probably benign Het
Gpc1 A T 1: 92,781,171 (GRCm39) H90L probably benign Het
Grwd1 A G 7: 45,475,438 (GRCm39) V368A probably damaging Het
Gstm3 G A 3: 107,876,555 (GRCm39) probably benign Het
Gtpbp6 A G 5: 110,252,252 (GRCm39) S427P probably damaging Het
Heatr5b C T 17: 79,126,252 (GRCm39) G560E probably damaging Het
Heatr9 A G 11: 83,409,019 (GRCm39) V176A probably damaging Het
Hsf2bp A G 17: 32,253,453 (GRCm39) V5A probably benign Het
Ints3 G T 3: 90,307,720 (GRCm39) Q660K probably benign Het
Itpr2 A T 6: 146,126,274 (GRCm39) L2048Q probably damaging Het
Kcnq1 G A 7: 142,660,342 (GRCm39) probably null Het
Lsm12 A T 11: 102,055,995 (GRCm39) probably null Het
Mcoln3 A G 3: 145,845,247 (GRCm39) Y481C probably damaging Het
Meis3 A G 7: 15,916,322 (GRCm39) N266D probably benign Het
Mgat5 G A 1: 127,339,941 (GRCm39) E441K probably benign Het
Mroh6 C T 15: 75,756,089 (GRCm39) R689H probably benign Het
Mtg1 T C 7: 139,729,662 (GRCm39) Y251H probably damaging Het
Mtus2 A T 5: 148,014,998 (GRCm39) Q597L probably benign Het
Myt1 A G 2: 181,439,390 (GRCm39) E346G probably benign Het
Nat8f4 A G 6: 85,877,873 (GRCm39) S217P probably benign Het
Ngf G A 3: 102,417,140 (GRCm39) G17R unknown Het
Or7e171-ps1 A T 9: 19,852,980 (GRCm39) M252K unknown Het
Pam T C 1: 97,749,572 (GRCm39) Y968C probably damaging Het
Pcdhga7 T A 18: 37,847,996 (GRCm39) M1K probably null Het
Pde8b G T 13: 95,170,679 (GRCm39) D554E probably benign Het
Pdzd7 G A 19: 45,033,962 (GRCm39) R41* probably null Het
Pkhd1l1 C T 15: 44,441,977 (GRCm39) P3639S probably damaging Het
Plce1 A T 19: 38,769,140 (GRCm39) E2280V probably damaging Het
Ryr1 T C 7: 28,804,257 (GRCm39) I538V probably benign Het
Scaf11 A G 15: 96,316,942 (GRCm39) L874P possibly damaging Het
Scpep1 G T 11: 88,824,347 (GRCm39) D307E possibly damaging Het
Septin4 A G 11: 87,480,065 (GRCm39) E327G probably damaging Het
Skint2 T G 4: 112,473,751 (GRCm39) V11G possibly damaging Het
Slc26a4 T C 12: 31,594,482 (GRCm39) N289D probably damaging Het
Slc35f3 CTCTCTCTCTCTCTCTCTCTCTCTCTCTCTCTCTCTCTCTCTC CTCTCTCTCTCTCTCTCTCTCTCTCTCTCTCTCTCTCTCTCTCTC 8: 127,115,777 (GRCm39) probably benign Het
Slx4 T C 16: 3,804,846 (GRCm39) E656G probably benign Het
Socs5 T C 17: 87,441,791 (GRCm39) S244P probably benign Het
Spata31h1 C T 10: 82,123,329 (GRCm39) C3227Y probably benign Het
Speer1e C A 5: 11,234,185 (GRCm39) H30Q probably benign Het
Stt3b A C 9: 115,105,887 (GRCm39) L196R probably damaging Het
Syne2 T A 12: 75,975,877 (GRCm39) probably null Het
Tab2 T A 10: 7,796,188 (GRCm39) N24I probably damaging Het
Taf4b T C 18: 14,946,331 (GRCm39) S385P probably damaging Het
Tg T C 15: 66,721,453 (GRCm39) Y2720H probably damaging Het
Tjap1 C T 17: 46,569,616 (GRCm39) G448E probably benign Het
Tll1 A T 8: 64,478,271 (GRCm39) C827* probably null Het
Tlr11 T A 14: 50,599,382 (GRCm39) I456K probably benign Het
Tmem209 T C 6: 30,497,854 (GRCm39) D305G probably damaging Het
Tmem82 A T 4: 141,345,035 (GRCm39) probably null Het
Tnfrsf14 A G 4: 155,007,750 (GRCm39) V207A probably benign Het
Tnks A T 8: 35,328,694 (GRCm39) N625K probably benign Het
Tomm20 G A 8: 127,666,700 (GRCm39) P58S possibly damaging Het
Ttc9b A G 7: 27,353,761 (GRCm39) D137G probably benign Het
Ulk4 C T 9: 121,092,734 (GRCm39) E168K possibly damaging Het
Usp9y T A Y: 1,444,573 (GRCm39) D122V probably damaging Het
Vps41 C A 13: 19,026,438 (GRCm39) T512K possibly damaging Het
Wdr49 T A 3: 75,182,335 (GRCm39) N698I probably benign Het
Zfp568 G A 7: 29,722,150 (GRCm39) C365Y probably damaging Het
Zfp663 A T 2: 165,194,453 (GRCm39) C589S probably damaging Het
Zfp971 A G 2: 177,675,292 (GRCm39) K297R probably damaging Het
Zkscan16 G T 4: 58,951,843 (GRCm39) E173* probably null Het
Other mutations in Grik3
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01135:Grik3 APN 4 125,526,208 (GRCm39) missense probably benign
IGL01534:Grik3 APN 4 125,579,983 (GRCm39) missense probably damaging 1.00
IGL01538:Grik3 APN 4 125,587,829 (GRCm39) missense possibly damaging 0.90
IGL02276:Grik3 APN 4 125,517,295 (GRCm39) missense possibly damaging 0.86
IGL02323:Grik3 APN 4 125,579,783 (GRCm39) splice site probably benign
IGL02475:Grik3 APN 4 125,544,310 (GRCm39) missense probably benign
IGL03198:Grik3 APN 4 125,553,555 (GRCm39) missense probably benign 0.25
IGL03307:Grik3 APN 4 125,535,347 (GRCm39) missense possibly damaging 0.91
R0054:Grik3 UTSW 4 125,517,368 (GRCm39) missense probably damaging 1.00
R0054:Grik3 UTSW 4 125,517,368 (GRCm39) missense probably damaging 1.00
R0116:Grik3 UTSW 4 125,564,349 (GRCm39) missense probably benign 0.01
R0208:Grik3 UTSW 4 125,579,958 (GRCm39) missense probably damaging 1.00
R0497:Grik3 UTSW 4 125,517,303 (GRCm39) missense possibly damaging 0.82
R1295:Grik3 UTSW 4 125,598,357 (GRCm39) splice site probably benign
R1296:Grik3 UTSW 4 125,598,357 (GRCm39) splice site probably benign
R1515:Grik3 UTSW 4 125,564,521 (GRCm39) missense probably benign 0.37
R1559:Grik3 UTSW 4 125,601,790 (GRCm39) missense probably benign 0.16
R1617:Grik3 UTSW 4 125,584,985 (GRCm39) missense probably benign
R1848:Grik3 UTSW 4 125,587,931 (GRCm39) missense probably damaging 1.00
R2903:Grik3 UTSW 4 125,564,437 (GRCm39) missense probably damaging 1.00
R3440:Grik3 UTSW 4 125,587,764 (GRCm39) missense probably damaging 1.00
R3440:Grik3 UTSW 4 125,587,763 (GRCm39) missense probably damaging 1.00
R3442:Grik3 UTSW 4 125,587,764 (GRCm39) missense probably damaging 1.00
R3442:Grik3 UTSW 4 125,587,763 (GRCm39) missense probably damaging 1.00
R3842:Grik3 UTSW 4 125,587,747 (GRCm39) splice site probably benign
R4649:Grik3 UTSW 4 125,544,278 (GRCm39) missense probably damaging 1.00
R4841:Grik3 UTSW 4 125,584,969 (GRCm39) missense probably damaging 1.00
R4842:Grik3 UTSW 4 125,584,969 (GRCm39) missense probably damaging 1.00
R5093:Grik3 UTSW 4 125,564,382 (GRCm39) missense probably benign
R5318:Grik3 UTSW 4 125,587,929 (GRCm39) missense probably damaging 0.96
R5549:Grik3 UTSW 4 125,579,838 (GRCm39) missense possibly damaging 0.95
R6221:Grik3 UTSW 4 125,598,916 (GRCm39) missense probably damaging 0.99
R6226:Grik3 UTSW 4 125,553,582 (GRCm39) missense probably benign 0.04
R6306:Grik3 UTSW 4 125,526,205 (GRCm39) missense probably benign 0.01
R6672:Grik3 UTSW 4 125,517,309 (GRCm39) missense probably benign 0.08
R6682:Grik3 UTSW 4 125,544,259 (GRCm39) missense probably damaging 1.00
R6783:Grik3 UTSW 4 125,526,093 (GRCm39) missense probably benign 0.01
R7390:Grik3 UTSW 4 125,543,532 (GRCm39) missense probably damaging 1.00
R7604:Grik3 UTSW 4 125,517,428 (GRCm39) missense probably damaging 0.97
R7822:Grik3 UTSW 4 125,550,190 (GRCm39) critical splice donor site probably null
R7952:Grik3 UTSW 4 125,598,340 (GRCm39) missense probably damaging 1.00
R8418:Grik3 UTSW 4 125,579,835 (GRCm39) missense possibly damaging 0.95
R8769:Grik3 UTSW 4 125,550,166 (GRCm39) missense probably damaging 1.00
R9030:Grik3 UTSW 4 125,526,185 (GRCm39) missense probably benign 0.24
R9243:Grik3 UTSW 4 125,601,690 (GRCm39) missense probably benign 0.00
R9792:Grik3 UTSW 4 125,526,315 (GRCm39) missense probably damaging 0.97
R9793:Grik3 UTSW 4 125,526,315 (GRCm39) missense probably damaging 0.97
Z1177:Grik3 UTSW 4 125,544,299 (GRCm39) missense possibly damaging 0.92
Predicted Primers PCR Primer
(F):5'- GTCCATGTTGACGTTGAACTGC -3'
(R):5'- TACCTGGCGATGACGAAGAG -3'

Sequencing Primer
(F):5'- CACTTAATGATCCCAGTGCTGAGG -3'
(R):5'- GGACACAGCTGACACCCAGG -3'
Posted On 2019-11-26