Incidental Mutation 'R7790:Tnks'
ID 599812
Institutional Source Beutler Lab
Gene Symbol Tnks
Ensembl Gene ENSMUSG00000031529
Gene Name tankyrase, TRF1-interacting ankyrin-related ADP-ribose polymerase
Synonyms mTNKS1, 4930554K12Rik, D130072O21Rik, TANK1, tankyrase 1
MMRRC Submission
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock # R7790 (G1)
Quality Score 225.009
Status Validated
Chromosome 8
Chromosomal Location 34826460-34965690 bp(-) (GRCm38)
Type of Mutation missense
DNA Base Change (assembly) A to T at 34861540 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change Asparagine to Lysine at position 625 (N625K)
Ref Sequence ENSEMBL: ENSMUSP00000033929 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000033929]
AlphaFold Q6PFX9
PDB Structure Crystal structure of a mouse Tankyrase-Axin complex [X-RAY DIFFRACTION]
Co-crystal structure of tankyrase 1 with compound 3 [(4S)-3-{4-[6-amino-5-(pyrimidin-2-yl)pyridin-3-yl]phenyl}-5,5-dimethyl-4-phenyl-1,3-oxazolidin-2-one] [X-RAY DIFFRACTION]
Predicted Effect probably benign
Transcript: ENSMUST00000033929
AA Change: N625K

PolyPhen 2 Score 0.014 (Sensitivity: 0.96; Specificity: 0.79)
SMART Domains Protein: ENSMUSP00000033929
Gene: ENSMUSG00000031529
AA Change: N625K

DomainStartEndE-ValueType
low complexity region 8 17 N/A INTRINSIC
low complexity region 20 55 N/A INTRINSIC
low complexity region 68 86 N/A INTRINSIC
low complexity region 91 175 N/A INTRINSIC
ANK 208 237 4.26e-4 SMART
ANK 241 270 3.23e-4 SMART
ANK 274 303 3.28e-5 SMART
ANK 327 355 2.66e3 SMART
ANK 361 390 7.64e-6 SMART
ANK 394 423 2.62e-4 SMART
ANK 427 456 1.99e-4 SMART
ANK 514 546 3.18e-3 SMART
ANK 550 579 1.51e-4 SMART
ANK 583 612 4.26e-4 SMART
ANK 642 670 2.21e3 SMART
ANK 676 705 4.03e-5 SMART
ANK 709 738 2.48e-5 SMART
ANK 742 771 1.64e-5 SMART
low complexity region 792 810 N/A INTRINSIC
ANK 829 858 1.47e-7 SMART
ANK 862 891 2.21e-2 SMART
ANK 895 924 3.13e-2 SMART
low complexity region 996 1010 N/A INTRINSIC
SAM 1017 1082 1.14e-12 SMART
Pfam:PARP 1098 1303 1.5e-28 PFAM
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.7%
  • 20x: 99.0%
Validation Efficiency 100% (81/81)
MGI Phenotype PHENOTYPE: Mice homozygous for a null allele fail to exhibit any abonormalities. Male mice homozygous for a gene trapped allele exhibit decreased fat pad weight, increased metabolism, hyperinsulinemia, and hypoglycemia. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 83 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700009N14Rik A T 4: 39,451,201 I136F possibly damaging Het
3110043O21Rik T C 4: 35,192,997 D444G unknown Het
4932415D10Rik C T 10: 82,287,495 C3227Y probably benign Het
Abca13 A T 11: 9,297,915 K2554M probably damaging Het
Ankrd12 C T 17: 65,984,230 D1403N possibly damaging Het
Ankrd17 A G 5: 90,260,152 V1402A possibly damaging Het
Ankrd36 A T 11: 5,635,176 N329I possibly damaging Het
Atr A T 9: 95,874,180 D815V probably damaging Het
Ceacam1 T C 7: 25,473,950 Y271C probably damaging Het
Cenpo T C 12: 4,214,597 H265R probably benign Het
Chd8 G A 14: 52,226,082 R702W probably damaging Het
Ckap5 A G 2: 91,559,110 N309S probably benign Het
Cxxc1 C T 18: 74,217,784 R83C probably damaging Het
Dcaf6 T C 1: 165,399,715 D281G probably damaging Het
Dennd4c A G 4: 86,799,517 T584A probably damaging Het
Dync2h1 G T 9: 7,114,914 H2415N probably damaging Het
Dzip1l A G 9: 99,660,962 E490G possibly damaging Het
Fam124a T C 14: 62,606,077 S345P probably benign Het
Fam83b G A 9: 76,492,048 T591I probably benign Het
Frem1 T C 4: 82,989,164 S838G probably benign Het
Fsip2 G T 2: 82,988,379 D4819Y probably benign Het
Gm43302 T G 5: 105,277,825 K246T probably benign Het
Gm5861 C A 5: 11,184,218 H30Q probably benign Het
Gml T C 15: 74,813,613 probably benign Het
Gpc1 A T 1: 92,853,449 H90L probably benign Het
Grik3 T C 4: 125,686,019 L519P probably damaging Het
Grwd1 A G 7: 45,826,014 V368A probably damaging Het
Gstm3 G A 3: 107,969,239 probably benign Het
Gtpbp6 A G 5: 110,104,386 S427P probably damaging Het
Heatr5b C T 17: 78,818,823 G560E probably damaging Het
Heatr9 A G 11: 83,518,193 V176A probably damaging Het
Hsf2bp A G 17: 32,034,479 V5A probably benign Het
Ints3 G T 3: 90,400,413 Q660K probably benign Het
Itpr2 A T 6: 146,224,776 L2048Q probably damaging Het
Kcnq1 G A 7: 143,106,605 probably null Het
Lsm12 A T 11: 102,165,169 probably null Het
Mcoln3 A G 3: 146,139,492 Y481C probably damaging Het
Meis3 A G 7: 16,182,397 N266D probably benign Het
Mgat5 G A 1: 127,412,204 E441K probably benign Het
Mroh6 C T 15: 75,884,240 R689H probably benign Het
Mtg1 T C 7: 140,149,749 Y251H probably damaging Het
Mtus2 A T 5: 148,078,188 Q597L probably benign Het
Myt1 A G 2: 181,797,597 E346G probably benign Het
Nat8f4 A G 6: 85,900,891 S217P probably benign Het
Ngf G A 3: 102,509,824 G17R unknown Het
Olfr863-ps1 A T 9: 19,941,684 M252K unknown Het
Pam T C 1: 97,821,847 Y968C probably damaging Het
Pcdhga7 T A 18: 37,714,943 M1K probably null Het
Pde8b G T 13: 95,034,171 D554E probably benign Het
Pdzd7 G A 19: 45,045,523 R41* probably null Het
Pkhd1l1 C T 15: 44,578,581 P3639S probably damaging Het
Plce1 A T 19: 38,780,696 E2280V probably damaging Het
Prrxl1 T A 14: 32,628,888 L227Q probably damaging Het
Ryr1 T C 7: 29,104,832 I538V probably benign Het
Scaf11 A G 15: 96,419,061 L874P possibly damaging Het
Scpep1 G T 11: 88,933,521 D307E possibly damaging Het
Sept4 A G 11: 87,589,239 E327G probably damaging Het
Skint2 T G 4: 112,616,554 V11G possibly damaging Het
Slc26a4 T C 12: 31,544,483 N289D probably damaging Het
Slc35f3 CTCTCTCTCTCTCTCTCTCTCTCTCTCTCTCTCTCTCTCTCTC CTCTCTCTCTCTCTCTCTCTCTCTCTCTCTCTCTCTCTCTCTCTC 8: 126,389,038 unknown Het
Slx4 T C 16: 3,986,982 E656G probably benign Het
Socs5 T C 17: 87,134,363 S244P probably benign Het
Stt3b A C 9: 115,276,819 L196R probably damaging Het
Syne2 T A 12: 75,929,103 probably null Het
Tab2 T A 10: 7,920,424 N24I probably damaging Het
Taf4b T C 18: 14,813,274 S385P probably damaging Het
Tg T C 15: 66,849,604 Y2720H probably damaging Het
Tjap1 C T 17: 46,258,690 G448E probably benign Het
Tll1 A T 8: 64,025,237 C827* probably null Het
Tlr11 T A 14: 50,361,925 I456K probably benign Het
Tmem209 T C 6: 30,497,855 D305G probably damaging Het
Tmem82 A T 4: 141,617,724 probably null Het
Tnfrsf14 A G 4: 154,923,293 V207A probably benign Het
Tomm20 G A 8: 126,939,950 P58S possibly damaging Het
Ttc9b A G 7: 27,654,336 D137G probably benign Het
Ulk4 C T 9: 121,263,668 E168K possibly damaging Het
Usp9y T A Y: 1,444,573 D122V probably damaging Het
Vps41 C A 13: 18,842,268 T512K possibly damaging Het
Wdr49 T A 3: 75,275,028 N698I probably benign Het
Zfp568 G A 7: 30,022,725 C365Y probably damaging Het
Zfp663 A T 2: 165,352,533 C589S probably damaging Het
Zfp971 A G 2: 178,033,499 K297R probably damaging Het
Zkscan16 G T 4: 58,951,843 E173* probably null Het
Other mutations in Tnks
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00498:Tnks APN 8 34861689 splice site probably benign
IGL00901:Tnks APN 8 34838395 nonsense probably null
IGL01448:Tnks APN 8 34839982 missense probably damaging 1.00
IGL01455:Tnks APN 8 34940900 missense probably damaging 0.99
IGL01962:Tnks APN 8 34869524 missense probably damaging 1.00
IGL02088:Tnks APN 8 34839994 missense possibly damaging 0.50
IGL02260:Tnks APN 8 34842983 missense probably damaging 0.99
IGL02454:Tnks APN 8 34831728 unclassified probably benign
IGL02486:Tnks APN 8 34851198 missense probably damaging 1.00
IGL02612:Tnks APN 8 34849299 missense possibly damaging 0.48
IGL03179:Tnks APN 8 34848670 missense probably benign 0.38
IGL03404:Tnks APN 8 34940704 missense probably damaging 1.00
R0256:Tnks UTSW 8 34861547 missense probably benign 0.07
R0265:Tnks UTSW 8 34839970 nonsense probably null
R0334:Tnks UTSW 8 34853259 nonsense probably null
R0414:Tnks UTSW 8 34853309 missense probably damaging 1.00
R0526:Tnks UTSW 8 34853303 missense probably benign 0.23
R0622:Tnks UTSW 8 34940822 missense probably damaging 1.00
R1445:Tnks UTSW 8 34834603 splice site probably benign
R1618:Tnks UTSW 8 34875276 missense probably damaging 1.00
R1779:Tnks UTSW 8 34857518 missense probably benign 0.18
R1919:Tnks UTSW 8 34875232 missense probably damaging 1.00
R1938:Tnks UTSW 8 34838530 missense probably damaging 1.00
R2018:Tnks UTSW 8 34851106 missense probably damaging 1.00
R2198:Tnks UTSW 8 34848649 missense probably benign
R2198:Tnks UTSW 8 34873067 missense probably benign 0.29
R2925:Tnks UTSW 8 34965661 missense unknown
R3828:Tnks UTSW 8 34873178 missense probably damaging 1.00
R3913:Tnks UTSW 8 34873074 missense probably damaging 0.99
R3916:Tnks UTSW 8 34853361 missense probably damaging 1.00
R3917:Tnks UTSW 8 34853361 missense probably damaging 1.00
R3930:Tnks UTSW 8 34940812 missense probably damaging 1.00
R4659:Tnks UTSW 8 34849311 missense possibly damaging 0.53
R4760:Tnks UTSW 8 34851783 missense probably benign 0.38
R5091:Tnks UTSW 8 34841809 missense probably benign 0.40
R5419:Tnks UTSW 8 34965566 missense unknown
R5558:Tnks UTSW 8 34965665 start codon destroyed probably null
R5582:Tnks UTSW 8 34940861 missense probably benign 0.14
R6035:Tnks UTSW 8 34918461 missense possibly damaging 0.93
R6035:Tnks UTSW 8 34918461 missense possibly damaging 0.93
R6495:Tnks UTSW 8 34839966 critical splice donor site probably null
R6527:Tnks UTSW 8 34873093 missense probably benign 0.36
R6991:Tnks UTSW 8 34834493 missense probably damaging 1.00
R7015:Tnks UTSW 8 34838547 missense probably benign 0.04
R7038:Tnks UTSW 8 34851636 missense probably damaging 0.99
R7057:Tnks UTSW 8 34840014 missense probably damaging 1.00
R7167:Tnks UTSW 8 34849304 missense probably damaging 0.98
R7250:Tnks UTSW 8 34851758 missense probably damaging 0.98
R7475:Tnks UTSW 8 34831712 missense probably damaging 1.00
R7818:Tnks UTSW 8 34873028 missense probably benign 0.03
R7909:Tnks UTSW 8 34940704 missense probably damaging 1.00
R7970:Tnks UTSW 8 34855926 critical splice donor site probably null
R8341:Tnks UTSW 8 34873045 missense probably damaging 1.00
R8343:Tnks UTSW 8 34834584 missense probably benign 0.03
R8870:Tnks UTSW 8 34847279 critical splice donor site probably null
R8936:Tnks UTSW 8 34853347 nonsense probably null
R9049:Tnks UTSW 8 34841778 missense probably damaging 0.96
R9080:Tnks UTSW 8 34965312 small deletion probably benign
R9182:Tnks UTSW 8 34841751 critical splice donor site probably null
R9211:Tnks UTSW 8 34849335 missense probably damaging 1.00
R9425:Tnks UTSW 8 34873665 missense probably damaging 1.00
Z1177:Tnks UTSW 8 34965145 missense probably benign 0.04
Predicted Primers PCR Primer
(F):5'- GTGCAGATCTCCTCCTGATAG -3'
(R):5'- ATGCCCAGTTTCACATGGAC -3'

Sequencing Primer
(F):5'- CACAAATTGGAGTTGGGGTGACTATG -3'
(R):5'- TGGACATCCAATGAATTTTCAGATG -3'
Posted On 2019-11-26