Incidental Mutation 'R7790:Dync2h1'
ID599816
Institutional Source Beutler Lab
Gene Symbol Dync2h1
Ensembl Gene ENSMUSG00000047193
Gene Namedynein cytoplasmic 2 heavy chain 1
Synonyms4432416O06Rik, DHC2, D030010H02Rik, D330044F14Rik, Dnchc2, DHC1b, b2b414Clo
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R7790 (G1)
Quality Score225.009
Status Not validated
Chromosome9
Chromosomal Location6928503-7184446 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) G to T at 7114914 bp
ZygosityHeterozygous
Amino Acid Change Histidine to Asparagine at position 2415 (H2415N)
Ref Sequence ENSEMBL: ENSMUSP00000046733 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000048417] [ENSMUST00000140466] [ENSMUST00000147193] [ENSMUST00000216097]
Predicted Effect probably damaging
Transcript: ENSMUST00000048417
AA Change: H2415N

PolyPhen 2 Score 0.963 (Sensitivity: 0.78; Specificity: 0.95)
SMART Domains Protein: ENSMUSP00000046733
Gene: ENSMUSG00000047193
AA Change: H2415N

DomainStartEndE-ValueType
Pfam:DHC_N1 187 676 1.6e-43 PFAM
Pfam:DHC_N2 1117 1523 4.1e-120 PFAM
AAA 1684 1830 3.72e-2 SMART
AAA 1971 2127 2.18e0 SMART
AAA 2283 2431 1.66e0 SMART
low complexity region 2588 2602 N/A INTRINSIC
Pfam:AAA_8 2618 2881 6.8e-27 PFAM
Pfam:MT 2894 3230 5.4e-28 PFAM
Pfam:AAA_9 3242 3471 1.1e-50 PFAM
Pfam:Dynein_heavy 3605 4304 2.3e-136 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000139671
SMART Domains Protein: ENSMUSP00000116242
Gene: ENSMUSG00000047193

DomainStartEndE-ValueType
low complexity region 59 73 N/A INTRINSIC
Pfam:AAA_8 89 352 3e-29 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000140466
AA Change: H2415N

PolyPhen 2 Score 0.963 (Sensitivity: 0.78; Specificity: 0.95)
SMART Domains Protein: ENSMUSP00000120007
Gene: ENSMUSG00000047193
AA Change: H2415N

DomainStartEndE-ValueType
Pfam:DHC_N1 187 676 1.6e-43 PFAM
Pfam:DHC_N2 1117 1523 4.1e-120 PFAM
AAA 1684 1830 3.72e-2 SMART
AAA 1971 2127 2.18e0 SMART
AAA 2283 2431 1.66e0 SMART
low complexity region 2588 2602 N/A INTRINSIC
Pfam:AAA_8 2618 2881 6.8e-27 PFAM
Pfam:MT 2894 3230 5.4e-28 PFAM
Pfam:AAA_9 3242 3471 1.1e-50 PFAM
Pfam:Dynein_heavy 3605 4304 2.3e-136 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000147193
AA Change: H2415N

PolyPhen 2 Score 0.998 (Sensitivity: 0.27; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000116679
Gene: ENSMUSG00000047193
AA Change: H2415N

DomainStartEndE-ValueType
Pfam:DHC_N1 188 674 4e-45 PFAM
Pfam:DHC_N2 1118 1521 5.5e-111 PFAM
AAA 1684 1830 3.72e-2 SMART
AAA 1971 2127 2.18e0 SMART
AAA 2283 2431 1.66e0 SMART
low complexity region 2588 2602 N/A INTRINSIC
Pfam:AAA_8 2618 2880 4.4e-27 PFAM
Pfam:MT 2894 3230 1.3e-27 PFAM
Pfam:AAA_9 3246 3477 1e-79 PFAM
Pfam:Dynein_heavy 3618 4310 8.5e-158 PFAM
Predicted Effect
Predicted Effect probably damaging
Transcript: ENSMUST00000216097
AA Change: H182N

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.7%
  • 20x: 99.0%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a large cytoplasmic dynein protein that is involved in retrograde transport in the cilium and has a role in intraflagellar transport, a process required for ciliary/flagellar assembly. Mutations in this gene cause a heterogeneous spectrum of conditions related to altered primary cilium function and often involve polydactyly, abnormal skeletogenesis, and polycystic kidneys. Alternative splicing results in multiple transcript variants encoding distinct proteins. [provided by RefSeq, Jan 2010]
PHENOTYPE: Homozygotes for a gene trap allele show complete embryonic lethality with altered heart looping and brain morphology. Chemically induced mutants show randomized heart looping and polydactyly. Holoprosencephaly or exencephaly, micrognathia, and cardiac, renal, airway and eye defects may be observed. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 79 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700009N14Rik A T 4: 39,451,201 I136F possibly damaging Het
3110043O21Rik T C 4: 35,192,997 D444G unknown Het
4932415D10Rik C T 10: 82,287,495 C3227Y probably benign Het
Abca13 A T 11: 9,297,915 K2554M probably damaging Het
Ankrd12 C T 17: 65,984,230 D1403N possibly damaging Het
Ankrd17 A G 5: 90,260,152 V1402A possibly damaging Het
Ankrd36 A T 11: 5,635,176 N329I possibly damaging Het
Atr A T 9: 95,874,180 D815V probably damaging Het
Ceacam1 T C 7: 25,473,950 Y271C probably damaging Het
Cenpo T C 12: 4,214,597 H265R probably benign Het
Chd8 G A 14: 52,226,082 R702W probably damaging Het
Ckap5 A G 2: 91,559,110 N309S probably benign Het
Cxxc1 C T 18: 74,217,784 R83C probably damaging Het
Dcaf6 T C 1: 165,399,715 D281G probably damaging Het
Dennd4c A G 4: 86,799,517 T584A probably damaging Het
Dzip1l A G 9: 99,660,962 E490G possibly damaging Het
Fam124a T C 14: 62,606,077 S345P probably benign Het
Fam83b G A 9: 76,492,048 T591I probably benign Het
Frem1 T C 4: 82,989,164 S838G probably benign Het
Fsip2 G T 2: 82,988,379 D4819Y probably benign Het
Gm43302 T G 5: 105,277,825 K246T probably benign Het
Gm5861 C A 5: 11,184,218 H30Q probably benign Het
Gml T C 15: 74,813,613 probably benign Het
Gpc1 A T 1: 92,853,449 H90L probably benign Het
Grik3 T C 4: 125,686,019 L519P probably damaging Het
Grwd1 A G 7: 45,826,014 V368A probably damaging Het
Gstm3 G A 3: 107,969,239 probably benign Het
Gtpbp6 A G 5: 110,104,386 S427P probably damaging Het
Heatr5b C T 17: 78,818,823 G560E probably damaging Het
Heatr9 A G 11: 83,518,193 V176A probably damaging Het
Hsf2bp A G 17: 32,034,479 V5A probably benign Het
Ints3 G T 3: 90,400,413 Q660K probably benign Het
Itpr2 A T 6: 146,224,776 L2048Q probably damaging Het
Mcoln3 A G 3: 146,139,492 Y481C probably damaging Het
Meis3 A G 7: 16,182,397 N266D probably benign Het
Mgat5 G A 1: 127,412,204 E441K probably benign Het
Mroh6 C T 15: 75,884,240 R689H probably benign Het
Mtg1 T C 7: 140,149,749 Y251H probably damaging Het
Mtus2 A T 5: 148,078,188 Q597L probably benign Het
Myt1 A G 2: 181,797,597 E346G probably benign Het
Nat8f4 A G 6: 85,900,891 S217P probably benign Het
Ngf G A 3: 102,509,824 G17R unknown Het
Olfr863-ps1 A T 9: 19,941,684 M252K unknown Het
Pam T C 1: 97,821,847 Y968C probably damaging Het
Pcdhga7 T A 18: 37,714,943 M1K probably null Het
Pde8b G T 13: 95,034,171 D554E probably benign Het
Pdzd7 G A 19: 45,045,523 R41* probably null Het
Pkhd1l1 C T 15: 44,578,581 P3639S probably damaging Het
Plce1 A T 19: 38,780,696 E2280V probably damaging Het
Prrxl1 T A 14: 32,628,888 L227Q probably damaging Het
Ryr1 T C 7: 29,104,832 I538V probably benign Het
Scaf11 A G 15: 96,419,061 L874P possibly damaging Het
Scpep1 G T 11: 88,933,521 D307E possibly damaging Het
Sept4 A G 11: 87,589,239 E327G probably damaging Het
Skint2 T G 4: 112,616,554 V11G possibly damaging Het
Slc26a4 T C 12: 31,544,483 N289D probably damaging Het
Slc35f3 CTCTCTCTCTCTCTCTCTCTCTCTCTCTCTCTCTCTCTCTCTC CTCTCTCTCTCTCTCTCTCTCTCTCTCTCTCTCTCTCTCTCTCTC 8: 126,389,038 unknown Het
Slx4 T C 16: 3,986,982 E656G probably benign Het
Socs5 T C 17: 87,134,363 S244P probably benign Het
Stt3b A C 9: 115,276,819 L196R probably damaging Het
Tab2 T A 10: 7,920,424 N24I probably damaging Het
Taf4b T C 18: 14,813,274 S385P probably damaging Het
Tg T C 15: 66,849,604 Y2720H probably damaging Het
Tjap1 C T 17: 46,258,690 G448E probably benign Het
Tll1 A T 8: 64,025,237 C827* probably null Het
Tlr11 T A 14: 50,361,925 I456K probably benign Het
Tmem209 T C 6: 30,497,855 D305G probably damaging Het
Tnfrsf14 A G 4: 154,923,293 V207A probably benign Het
Tnks A T 8: 34,861,540 N625K probably benign Het
Tomm20 G A 8: 126,939,950 P58S possibly damaging Het
Ttc9b A G 7: 27,654,336 D137G probably benign Het
Ulk4 C T 9: 121,263,668 E168K possibly damaging Het
Usp9y T A Y: 1,444,573 D122V probably damaging Het
Vps41 C A 13: 18,842,268 T512K possibly damaging Het
Wdr49 T A 3: 75,275,028 N698I probably benign Het
Zfp568 G A 7: 30,022,725 C365Y probably damaging Het
Zfp663 A T 2: 165,352,533 C589S probably damaging Het
Zfp971 A G 2: 178,033,499 K297R probably damaging Het
Zkscan16 G T 4: 58,951,843 E173* probably null Het
Other mutations in Dync2h1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00159:Dync2h1 APN 9 7158839 missense probably benign 0.42
IGL00310:Dync2h1 APN 9 7155072 splice site probably benign
IGL00499:Dync2h1 APN 9 7168700 missense possibly damaging 0.95
IGL00579:Dync2h1 APN 9 7035728 splice site probably benign
IGL00660:Dync2h1 APN 9 7075797 missense probably damaging 0.98
IGL00964:Dync2h1 APN 9 7174881 splice site probably benign
IGL01025:Dync2h1 APN 9 7162789 missense probably damaging 1.00
IGL01093:Dync2h1 APN 9 7145611 missense probably benign 0.01
IGL01108:Dync2h1 APN 9 7176771 missense possibly damaging 0.87
IGL01126:Dync2h1 APN 9 7116588 missense probably benign 0.00
IGL01474:Dync2h1 APN 9 7102493 missense probably benign 0.01
IGL01531:Dync2h1 APN 9 7071111 missense probably benign 0.11
IGL01548:Dync2h1 APN 9 7071922 missense probably damaging 1.00
IGL01621:Dync2h1 APN 9 7140897 critical splice donor site probably null
IGL01672:Dync2h1 APN 9 7118884 nonsense probably null
IGL01681:Dync2h1 APN 9 7142196 splice site probably null
IGL01685:Dync2h1 APN 9 7142297 missense probably damaging 1.00
IGL01724:Dync2h1 APN 9 7081077 missense probably benign 0.03
IGL01738:Dync2h1 APN 9 7114922 missense possibly damaging 0.77
IGL01783:Dync2h1 APN 9 7118822 unclassified probably benign
IGL01813:Dync2h1 APN 9 7122799 missense probably damaging 1.00
IGL01931:Dync2h1 APN 9 7114973 missense probably damaging 1.00
IGL01931:Dync2h1 APN 9 7011207 missense probably benign 0.33
IGL02105:Dync2h1 APN 9 7075892 missense probably damaging 1.00
IGL02137:Dync2h1 APN 9 7134349 missense probably benign
IGL02140:Dync2h1 APN 9 7147791 missense probably benign
IGL02175:Dync2h1 APN 9 7111548 missense possibly damaging 0.91
IGL02283:Dync2h1 APN 9 7125912 missense probably damaging 0.99
IGL02305:Dync2h1 APN 9 7122678 missense probably benign
IGL02342:Dync2h1 APN 9 7142246 missense probably damaging 1.00
IGL02367:Dync2h1 APN 9 7158926 missense probably damaging 0.98
IGL02458:Dync2h1 APN 9 7117422 missense probably damaging 1.00
IGL02563:Dync2h1 APN 9 7035700 missense possibly damaging 0.95
IGL02825:Dync2h1 APN 9 6955901 splice site probably benign
IGL02955:Dync2h1 APN 9 7142864 missense probably benign 0.00
IGL02992:Dync2h1 APN 9 7137074 missense probably benign 0.01
IGL02996:Dync2h1 APN 9 6935279 missense probably damaging 0.99
IGL03224:Dync2h1 APN 9 7076235 missense probably benign 0.32
IGL03226:Dync2h1 APN 9 7125918 missense probably benign
IGL03233:Dync2h1 APN 9 7101525 missense possibly damaging 0.90
deinonychus UTSW 9 7159478 splice site probably null
R0016:Dync2h1 UTSW 9 7144346 splice site probably benign
R0016:Dync2h1 UTSW 9 7144346 splice site probably benign
R0043:Dync2h1 UTSW 9 7005574 missense probably benign 0.05
R0109:Dync2h1 UTSW 9 7111487 missense probably damaging 1.00
R0109:Dync2h1 UTSW 9 7111487 missense probably damaging 1.00
R0121:Dync2h1 UTSW 9 7001327 splice site probably benign
R0277:Dync2h1 UTSW 9 7129046 missense probably benign
R0360:Dync2h1 UTSW 9 7113182 missense possibly damaging 0.62
R0362:Dync2h1 UTSW 9 7005487 splice site probably null
R0389:Dync2h1 UTSW 9 7167244 splice site probably null
R0443:Dync2h1 UTSW 9 7167244 splice site probably null
R0496:Dync2h1 UTSW 9 7155180 missense probably benign 0.42
R0506:Dync2h1 UTSW 9 7113153 missense probably benign 0.05
R0511:Dync2h1 UTSW 9 7122692 missense probably benign 0.00
R0540:Dync2h1 UTSW 9 7051480 missense probably benign 0.00
R0550:Dync2h1 UTSW 9 7120954 intron probably null
R0564:Dync2h1 UTSW 9 7139432 missense probably damaging 1.00
R0607:Dync2h1 UTSW 9 7051480 missense probably benign 0.00
R0699:Dync2h1 UTSW 9 7103680 missense probably benign 0.00
R0725:Dync2h1 UTSW 9 7015497 missense possibly damaging 0.93
R0835:Dync2h1 UTSW 9 7116642 critical splice acceptor site probably null
R0837:Dync2h1 UTSW 9 7077979 missense probably benign 0.07
R0894:Dync2h1 UTSW 9 7041734 splice site probably benign
R0938:Dync2h1 UTSW 9 7002658 missense probably benign 0.02
R1056:Dync2h1 UTSW 9 7147731 missense probably benign 0.15
R1081:Dync2h1 UTSW 9 7005488 critical splice donor site probably null
R1178:Dync2h1 UTSW 9 7101193 splice site probably benign
R1243:Dync2h1 UTSW 9 7120882 missense probably benign
R1295:Dync2h1 UTSW 9 7075752 splice site probably benign
R1304:Dync2h1 UTSW 9 7102318 missense probably damaging 1.00
R1387:Dync2h1 UTSW 9 7125816 missense probably benign
R1513:Dync2h1 UTSW 9 7103663 missense possibly damaging 0.74
R1557:Dync2h1 UTSW 9 7140911 missense probably damaging 1.00
R1568:Dync2h1 UTSW 9 7157553 missense probably null 0.02
R1570:Dync2h1 UTSW 9 7176926 missense probably benign 0.12
R1670:Dync2h1 UTSW 9 6993942 missense possibly damaging 0.82
R1713:Dync2h1 UTSW 9 7131891 missense probably benign
R1766:Dync2h1 UTSW 9 7015526 critical splice acceptor site probably null
R1773:Dync2h1 UTSW 9 7128256 missense probably damaging 1.00
R1786:Dync2h1 UTSW 9 7081084 missense probably damaging 1.00
R1848:Dync2h1 UTSW 9 7049166 missense probably benign 0.01
R1850:Dync2h1 UTSW 9 7001448 missense probably benign 0.00
R1935:Dync2h1 UTSW 9 7139159 critical splice donor site probably null
R1936:Dync2h1 UTSW 9 7139159 critical splice donor site probably null
R1937:Dync2h1 UTSW 9 7139159 critical splice donor site probably null
R1939:Dync2h1 UTSW 9 7139159 critical splice donor site probably null
R1940:Dync2h1 UTSW 9 7139159 critical splice donor site probably null
R1944:Dync2h1 UTSW 9 7001377 missense probably damaging 1.00
R1976:Dync2h1 UTSW 9 7129045 missense probably benign
R2012:Dync2h1 UTSW 9 7169589 missense probably benign 0.00
R2020:Dync2h1 UTSW 9 7122772 missense probably damaging 0.99
R2020:Dync2h1 UTSW 9 7162925 missense probably benign 0.25
R2024:Dync2h1 UTSW 9 7129062 missense probably damaging 0.97
R2038:Dync2h1 UTSW 9 6967226 missense probably damaging 0.99
R2045:Dync2h1 UTSW 9 7160171 missense probably damaging 1.00
R2060:Dync2h1 UTSW 9 7162802 missense possibly damaging 0.92
R2094:Dync2h1 UTSW 9 7148735 missense probably benign 0.18
R2129:Dync2h1 UTSW 9 7175289 missense possibly damaging 0.94
R2130:Dync2h1 UTSW 9 7011253 missense probably damaging 1.00
R2136:Dync2h1 UTSW 9 7122772 missense probably damaging 0.99
R2164:Dync2h1 UTSW 9 7124797 missense probably damaging 1.00
R2242:Dync2h1 UTSW 9 7037828 splice site probably null
R2255:Dync2h1 UTSW 9 6955905 critical splice donor site probably null
R2357:Dync2h1 UTSW 9 7081053 missense probably benign 0.03
R2389:Dync2h1 UTSW 9 7122618 missense possibly damaging 0.82
R2412:Dync2h1 UTSW 9 7144246 missense probably benign 0.01
R2885:Dync2h1 UTSW 9 7102329 missense probably damaging 1.00
R2909:Dync2h1 UTSW 9 7049114 missense probably damaging 1.00
R3434:Dync2h1 UTSW 9 7011236 missense probably benign
R3719:Dync2h1 UTSW 9 7006882 splice site probably benign
R3723:Dync2h1 UTSW 9 7041658 missense probably benign 0.17
R3800:Dync2h1 UTSW 9 7101525 missense possibly damaging 0.90
R3803:Dync2h1 UTSW 9 6935293 missense probably benign 0.00
R3936:Dync2h1 UTSW 9 7001482 missense probably damaging 1.00
R3941:Dync2h1 UTSW 9 7124825 missense probably benign
R3950:Dync2h1 UTSW 9 7112061 nonsense probably null
R4004:Dync2h1 UTSW 9 7117404 missense probably damaging 1.00
R4091:Dync2h1 UTSW 9 7131881 missense probably benign 0.01
R4233:Dync2h1 UTSW 9 7134360 missense probably benign 0.02
R4302:Dync2h1 UTSW 9 7077880 missense probably benign 0.02
R4451:Dync2h1 UTSW 9 6983477 missense probably benign 0.02
R4512:Dync2h1 UTSW 9 7085009 nonsense probably null
R4596:Dync2h1 UTSW 9 6992595 missense probably benign
R4604:Dync2h1 UTSW 9 7140995 missense probably benign 0.00
R4614:Dync2h1 UTSW 9 7011290 missense probably benign 0.03
R4667:Dync2h1 UTSW 9 7051411 missense probably benign 0.00
R4671:Dync2h1 UTSW 9 7169640 missense possibly damaging 0.82
R4714:Dync2h1 UTSW 9 7118932 missense possibly damaging 0.86
R4716:Dync2h1 UTSW 9 7142648 critical splice donor site probably null
R4736:Dync2h1 UTSW 9 7006862 missense probably benign 0.00
R4807:Dync2h1 UTSW 9 7139422 missense probably benign 0.31
R4850:Dync2h1 UTSW 9 7134364 missense probably benign 0.14
R4862:Dync2h1 UTSW 9 7147717 missense probably benign
R4899:Dync2h1 UTSW 9 7131921 nonsense probably null
R4971:Dync2h1 UTSW 9 7131949 missense probably benign
R5040:Dync2h1 UTSW 9 6992625 missense probably benign 0.09
R5054:Dync2h1 UTSW 9 7085007 missense possibly damaging 0.63
R5274:Dync2h1 UTSW 9 7116540 missense probably benign 0.00
R5307:Dync2h1 UTSW 9 7155099 missense probably damaging 1.00
R5347:Dync2h1 UTSW 9 7129727 missense probably damaging 1.00
R5372:Dync2h1 UTSW 9 7176962 unclassified probably benign
R5384:Dync2h1 UTSW 9 7016791 missense probably damaging 0.99
R5385:Dync2h1 UTSW 9 7016791 missense probably damaging 0.99
R5394:Dync2h1 UTSW 9 7120899 nonsense probably null
R5402:Dync2h1 UTSW 9 7114949 missense probably damaging 1.00
R5446:Dync2h1 UTSW 9 7144217 missense probably benign
R5538:Dync2h1 UTSW 9 7168630 intron probably benign
R5551:Dync2h1 UTSW 9 7031718 missense possibly damaging 0.74
R5619:Dync2h1 UTSW 9 7118885 missense probably benign 0.02
R5621:Dync2h1 UTSW 9 7120909 missense possibly damaging 0.86
R5652:Dync2h1 UTSW 9 7116638 missense probably benign 0.45
R5655:Dync2h1 UTSW 9 7148659 missense probably benign 0.01
R5689:Dync2h1 UTSW 9 7169689 missense probably damaging 1.00
R5725:Dync2h1 UTSW 9 7169528 missense probably benign 0.21
R5742:Dync2h1 UTSW 9 7165762 missense possibly damaging 0.64
R5817:Dync2h1 UTSW 9 6996905 missense probably damaging 1.00
R5852:Dync2h1 UTSW 9 7011290 missense probably benign 0.03
R5898:Dync2h1 UTSW 9 7148717 missense probably benign 0.00
R5916:Dync2h1 UTSW 9 7102309 critical splice donor site probably null
R5939:Dync2h1 UTSW 9 7037801 missense probably damaging 0.99
R5942:Dync2h1 UTSW 9 7117466 nonsense probably null
R5982:Dync2h1 UTSW 9 6955986 missense probably benign 0.00
R6029:Dync2h1 UTSW 9 7157646 missense probably benign
R6125:Dync2h1 UTSW 9 7168706 missense probably damaging 1.00
R6209:Dync2h1 UTSW 9 7165677 missense probably benign 0.01
R6247:Dync2h1 UTSW 9 7135078 missense probably damaging 1.00
R6294:Dync2h1 UTSW 9 7084986 missense probably benign 0.01
R6328:Dync2h1 UTSW 9 7165717 missense probably benign 0.00
R6376:Dync2h1 UTSW 9 7165703 missense probably benign 0.21
R6394:Dync2h1 UTSW 9 7168331 missense probably damaging 0.99
R6539:Dync2h1 UTSW 9 7159478 splice site probably null
R6554:Dync2h1 UTSW 9 7037699 missense probably benign 0.39
R6559:Dync2h1 UTSW 9 7139501 missense possibly damaging 0.72
R6563:Dync2h1 UTSW 9 7120819 missense probably benign 0.27
R6807:Dync2h1 UTSW 9 7041718 missense probably benign 0.10
R6848:Dync2h1 UTSW 9 7159632 missense probably benign 0.22
R6901:Dync2h1 UTSW 9 7131855 missense probably damaging 1.00
R6921:Dync2h1 UTSW 9 7102549 missense probably benign
R6997:Dync2h1 UTSW 9 7168743 missense probably null 0.00
R7084:Dync2h1 UTSW 9 7113214 missense possibly damaging 0.72
R7113:Dync2h1 UTSW 9 7075788 missense probably benign 0.03
R7131:Dync2h1 UTSW 9 7075786 missense probably damaging 1.00
R7165:Dync2h1 UTSW 9 7050479 missense probably benign
R7196:Dync2h1 UTSW 9 7147715 nonsense probably null
R7208:Dync2h1 UTSW 9 7141059 missense probably damaging 1.00
R7225:Dync2h1 UTSW 9 7142756 missense probably benign
R7237:Dync2h1 UTSW 9 6993966 missense probably benign 0.00
R7243:Dync2h1 UTSW 9 7102405 missense possibly damaging 0.64
R7291:Dync2h1 UTSW 9 6929590 missense possibly damaging 0.69
R7293:Dync2h1 UTSW 9 7001454 missense possibly damaging 0.88
R7329:Dync2h1 UTSW 9 7011247 missense probably benign
R7351:Dync2h1 UTSW 9 7167145 missense probably damaging 1.00
R7358:Dync2h1 UTSW 9 7159479 critical splice donor site probably null
R7387:Dync2h1 UTSW 9 7157932 missense possibly damaging 0.68
R7446:Dync2h1 UTSW 9 7041720 missense probably benign 0.03
R7487:Dync2h1 UTSW 9 7132041 missense probably benign 0.26
R7488:Dync2h1 UTSW 9 7124855 missense probably benign 0.03
R7496:Dync2h1 UTSW 9 7135015 splice site probably null
R7501:Dync2h1 UTSW 9 7175336 missense possibly damaging 0.82
R7571:Dync2h1 UTSW 9 7002623 missense probably damaging 1.00
R7627:Dync2h1 UTSW 9 7101111 missense probably benign 0.00
R7639:Dync2h1 UTSW 9 7141254 missense probably damaging 0.97
R7653:Dync2h1 UTSW 9 7117570 missense probably benign
R7654:Dync2h1 UTSW 9 7122664 missense probably damaging 1.00
R7742:Dync2h1 UTSW 9 7076232 missense probably benign 0.00
R7755:Dync2h1 UTSW 9 7015490 missense probably benign 0.00
R7762:Dync2h1 UTSW 9 7129719 missense probably benign 0.01
R7834:Dync2h1 UTSW 9 7118953 missense probably benign 0.04
R7883:Dync2h1 UTSW 9 7005566 missense possibly damaging 0.80
R7917:Dync2h1 UTSW 9 7118953 missense probably benign 0.04
R7966:Dync2h1 UTSW 9 7005566 missense possibly damaging 0.80
X0009:Dync2h1 UTSW 9 7117576 missense possibly damaging 0.81
Z1176:Dync2h1 UTSW 9 7142361 missense probably damaging 0.99
Z1176:Dync2h1 UTSW 9 7168730 frame shift probably null
Z1177:Dync2h1 UTSW 9 7102427 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- GCCAGGGTCAAAAGTTTGGG -3'
(R):5'- GGTAAAAGGTGGTGGTTTCACATAG -3'

Sequencing Primer
(F):5'- CTTGGTGGGTATCCTGAATAA -3'
(R):5'- GCTTTGTCATACCAAGGAGTCAAGC -3'
Posted On2019-11-26