Incidental Mutation 'R7790:Ulk4'
ID 599822
Institutional Source Beutler Lab
Gene Symbol Ulk4
Ensembl Gene ENSMUSG00000040936
Gene Name unc-51-like kinase 4
Synonyms 4932415A06Rik
MMRRC Submission 045846-MU
Accession Numbers
Essential gene? Possibly essential (E-score: 0.682) question?
Stock # R7790 (G1)
Quality Score 225.009
Status Validated
Chromosome 9
Chromosomal Location 120793520-121115225 bp(-) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) C to T at 121092734 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Glutamic Acid to Lysine at position 168 (E168K)
Ref Sequence ENSEMBL: ENSMUSP00000057960 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000051479] [ENSMUST00000051565] [ENSMUST00000171061] [ENSMUST00000171923]
AlphaFold no structure available at present
Predicted Effect possibly damaging
Transcript: ENSMUST00000051479
AA Change: E168K

PolyPhen 2 Score 0.704 (Sensitivity: 0.86; Specificity: 0.92)
SMART Domains Protein: ENSMUSP00000057960
Gene: ENSMUSG00000040936
AA Change: E168K

DomainStartEndE-ValueType
Pfam:Pkinase_Tyr 4 277 9.9e-26 PFAM
Pfam:Pkinase 4 280 4.6e-49 PFAM
low complexity region 949 964 N/A INTRINSIC
low complexity region 968 985 N/A INTRINSIC
low complexity region 1107 1119 N/A INTRINSIC
low complexity region 1147 1161 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000051565
SMART Domains Protein: ENSMUSP00000054833
Gene: ENSMUSG00000040936

DomainStartEndE-ValueType
SCOP:d1jvpp_ 1 32 9e-6 SMART
Blast:S_TKc 4 45 2e-8 BLAST
Predicted Effect possibly damaging
Transcript: ENSMUST00000171061
AA Change: E168K

PolyPhen 2 Score 0.839 (Sensitivity: 0.84; Specificity: 0.93)
SMART Domains Protein: ENSMUSP00000129214
Gene: ENSMUSG00000040936
AA Change: E168K

DomainStartEndE-ValueType
Pfam:Pkinase_Tyr 4 277 4.3e-26 PFAM
Pfam:Pkinase 4 280 2.1e-49 PFAM
Predicted Effect possibly damaging
Transcript: ENSMUST00000171923
AA Change: E168K

PolyPhen 2 Score 0.930 (Sensitivity: 0.81; Specificity: 0.94)
SMART Domains Protein: ENSMUSP00000131342
Gene: ENSMUSG00000040936
AA Change: E168K

DomainStartEndE-ValueType
Pfam:Pkinase_Tyr 4 153 3.1e-14 PFAM
Pfam:Pkinase 4 280 4.9e-50 PFAM
Pfam:Pkinase_Tyr 165 277 6.1e-10 PFAM
low complexity region 949 964 N/A INTRINSIC
low complexity region 968 985 N/A INTRINSIC
low complexity region 1107 1119 N/A INTRINSIC
low complexity region 1147 1171 N/A INTRINSIC
Meta Mutation Damage Score 0.1629 question?
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.7%
  • 20x: 99.0%
Validation Efficiency 100% (81/81)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of the unc-51-like serine/threonine kinase (STK) family. Members of this protein family play a role in neuronal growth and endocytosis. The encoded protein is likely involved in neurite branching, neurite elongation and neuronal migration. Genome-wide association studies (GWAS) indicate an association of variations in this gene with blood pressure and hypertension. Sequence variations in this gene may also be be associated with psychiatric disorders, including schizophrenia and bipolar disorder. Pseudogenes associated with this gene have been identified and are located on chromosome 15. [provided by RefSeq, Jul 2016]
PHENOTYPE: Homozygotes for a null allele show reduced body size, hydrocephaly, dilated brain ventricles, otitis media, and premature death. Hypomorphic mice show partial corpus callosum aplasia, hydrocephaly, subcommissural organ and ependymal motile ciliary defects, aqueduct stenosis, and impaired CSF flow. [provided by MGI curators]
Allele List at MGI

All alleles(2) : Targeted, other(1) Gene trapped(1)

Other mutations in this stock
Total: 83 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700009N14Rik A T 4: 39,451,201 (GRCm39) I136F possibly damaging Het
Abca13 A T 11: 9,247,915 (GRCm39) K2554M probably damaging Het
Ankrd12 C T 17: 66,291,225 (GRCm39) D1403N possibly damaging Het
Ankrd17 A G 5: 90,408,011 (GRCm39) V1402A possibly damaging Het
Ankrd36 A T 11: 5,585,176 (GRCm39) N329I possibly damaging Het
Atr A T 9: 95,756,233 (GRCm39) D815V probably damaging Het
C9orf72 T C 4: 35,192,997 (GRCm39) D444G unknown Het
Ceacam1 T C 7: 25,173,375 (GRCm39) Y271C probably damaging Het
Cenpo T C 12: 4,264,597 (GRCm39) H265R probably benign Het
Chd8 G A 14: 52,463,539 (GRCm39) R702W probably damaging Het
Ckap5 A G 2: 91,389,455 (GRCm39) N309S probably benign Het
Cxxc1 C T 18: 74,350,855 (GRCm39) R83C probably damaging Het
Dcaf6 T C 1: 165,227,284 (GRCm39) D281G probably damaging Het
Dennd4c A G 4: 86,717,754 (GRCm39) T584A probably damaging Het
Drgx T A 14: 32,350,845 (GRCm39) L227Q probably damaging Het
Dync2h1 G T 9: 7,114,914 (GRCm39) H2415N probably damaging Het
Dzip1l A G 9: 99,543,015 (GRCm39) E490G possibly damaging Het
Fam124a T C 14: 62,843,526 (GRCm39) S345P probably benign Het
Fam83b G A 9: 76,399,330 (GRCm39) T591I probably benign Het
Frem1 T C 4: 82,907,401 (GRCm39) S838G probably benign Het
Fsip2 G T 2: 82,818,723 (GRCm39) D4819Y probably benign Het
Gm43302 T G 5: 105,425,691 (GRCm39) K246T probably benign Het
Gml T C 15: 74,685,462 (GRCm39) probably benign Het
Gpc1 A T 1: 92,781,171 (GRCm39) H90L probably benign Het
Grik3 T C 4: 125,579,812 (GRCm39) L519P probably damaging Het
Grwd1 A G 7: 45,475,438 (GRCm39) V368A probably damaging Het
Gstm3 G A 3: 107,876,555 (GRCm39) probably benign Het
Gtpbp6 A G 5: 110,252,252 (GRCm39) S427P probably damaging Het
Heatr5b C T 17: 79,126,252 (GRCm39) G560E probably damaging Het
Heatr9 A G 11: 83,409,019 (GRCm39) V176A probably damaging Het
Hsf2bp A G 17: 32,253,453 (GRCm39) V5A probably benign Het
Ints3 G T 3: 90,307,720 (GRCm39) Q660K probably benign Het
Itpr2 A T 6: 146,126,274 (GRCm39) L2048Q probably damaging Het
Kcnq1 G A 7: 142,660,342 (GRCm39) probably null Het
Lsm12 A T 11: 102,055,995 (GRCm39) probably null Het
Mcoln3 A G 3: 145,845,247 (GRCm39) Y481C probably damaging Het
Meis3 A G 7: 15,916,322 (GRCm39) N266D probably benign Het
Mgat5 G A 1: 127,339,941 (GRCm39) E441K probably benign Het
Mroh6 C T 15: 75,756,089 (GRCm39) R689H probably benign Het
Mtg1 T C 7: 139,729,662 (GRCm39) Y251H probably damaging Het
Mtus2 A T 5: 148,014,998 (GRCm39) Q597L probably benign Het
Myt1 A G 2: 181,439,390 (GRCm39) E346G probably benign Het
Nat8f4 A G 6: 85,877,873 (GRCm39) S217P probably benign Het
Ngf G A 3: 102,417,140 (GRCm39) G17R unknown Het
Or7e171-ps1 A T 9: 19,852,980 (GRCm39) M252K unknown Het
Pam T C 1: 97,749,572 (GRCm39) Y968C probably damaging Het
Pcdhga7 T A 18: 37,847,996 (GRCm39) M1K probably null Het
Pde8b G T 13: 95,170,679 (GRCm39) D554E probably benign Het
Pdzd7 G A 19: 45,033,962 (GRCm39) R41* probably null Het
Pkhd1l1 C T 15: 44,441,977 (GRCm39) P3639S probably damaging Het
Plce1 A T 19: 38,769,140 (GRCm39) E2280V probably damaging Het
Ryr1 T C 7: 28,804,257 (GRCm39) I538V probably benign Het
Scaf11 A G 15: 96,316,942 (GRCm39) L874P possibly damaging Het
Scpep1 G T 11: 88,824,347 (GRCm39) D307E possibly damaging Het
Septin4 A G 11: 87,480,065 (GRCm39) E327G probably damaging Het
Skint2 T G 4: 112,473,751 (GRCm39) V11G possibly damaging Het
Slc26a4 T C 12: 31,594,482 (GRCm39) N289D probably damaging Het
Slc35f3 CTCTCTCTCTCTCTCTCTCTCTCTCTCTCTCTCTCTCTCTCTC CTCTCTCTCTCTCTCTCTCTCTCTCTCTCTCTCTCTCTCTCTCTC 8: 127,115,777 (GRCm39) probably benign Het
Slx4 T C 16: 3,804,846 (GRCm39) E656G probably benign Het
Socs5 T C 17: 87,441,791 (GRCm39) S244P probably benign Het
Spata31h1 C T 10: 82,123,329 (GRCm39) C3227Y probably benign Het
Speer1e C A 5: 11,234,185 (GRCm39) H30Q probably benign Het
Stt3b A C 9: 115,105,887 (GRCm39) L196R probably damaging Het
Syne2 T A 12: 75,975,877 (GRCm39) probably null Het
Tab2 T A 10: 7,796,188 (GRCm39) N24I probably damaging Het
Taf4b T C 18: 14,946,331 (GRCm39) S385P probably damaging Het
Tg T C 15: 66,721,453 (GRCm39) Y2720H probably damaging Het
Tjap1 C T 17: 46,569,616 (GRCm39) G448E probably benign Het
Tll1 A T 8: 64,478,271 (GRCm39) C827* probably null Het
Tlr11 T A 14: 50,599,382 (GRCm39) I456K probably benign Het
Tmem209 T C 6: 30,497,854 (GRCm39) D305G probably damaging Het
Tmem82 A T 4: 141,345,035 (GRCm39) probably null Het
Tnfrsf14 A G 4: 155,007,750 (GRCm39) V207A probably benign Het
Tnks A T 8: 35,328,694 (GRCm39) N625K probably benign Het
Tomm20 G A 8: 127,666,700 (GRCm39) P58S possibly damaging Het
Ttc9b A G 7: 27,353,761 (GRCm39) D137G probably benign Het
Usp9y T A Y: 1,444,573 (GRCm39) D122V probably damaging Het
Vps41 C A 13: 19,026,438 (GRCm39) T512K possibly damaging Het
Wdr49 T A 3: 75,182,335 (GRCm39) N698I probably benign Het
Zfp568 G A 7: 29,722,150 (GRCm39) C365Y probably damaging Het
Zfp663 A T 2: 165,194,453 (GRCm39) C589S probably damaging Het
Zfp971 A G 2: 177,675,292 (GRCm39) K297R probably damaging Het
Zkscan16 G T 4: 58,951,843 (GRCm39) E173* probably null Het
Other mutations in Ulk4
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01122:Ulk4 APN 9 120,997,358 (GRCm39) missense possibly damaging 0.48
IGL01345:Ulk4 APN 9 121,037,228 (GRCm39) missense possibly damaging 0.48
IGL01432:Ulk4 APN 9 121,095,367 (GRCm39) missense probably damaging 1.00
IGL01807:Ulk4 APN 9 121,084,251 (GRCm39) missense probably damaging 1.00
IGL02139:Ulk4 APN 9 120,970,897 (GRCm39) splice site probably null
IGL02266:Ulk4 APN 9 120,910,766 (GRCm39) missense probably benign 0.10
IGL02511:Ulk4 APN 9 121,017,420 (GRCm39) missense probably damaging 1.00
IGL02546:Ulk4 APN 9 120,981,373 (GRCm39) nonsense probably null
IGL02687:Ulk4 APN 9 121,021,728 (GRCm39) missense possibly damaging 0.89
IGL03220:Ulk4 APN 9 120,974,402 (GRCm39) missense probably damaging 1.00
3-1:Ulk4 UTSW 9 121,084,237 (GRCm39) missense probably benign 0.02
R0031:Ulk4 UTSW 9 121,102,048 (GRCm39) missense probably damaging 1.00
R0433:Ulk4 UTSW 9 120,873,885 (GRCm39) missense probably benign 0.27
R0513:Ulk4 UTSW 9 120,981,391 (GRCm39) missense probably benign 0.13
R0524:Ulk4 UTSW 9 121,081,717 (GRCm39) critical splice donor site probably null
R1268:Ulk4 UTSW 9 121,086,140 (GRCm39) splice site probably benign
R1439:Ulk4 UTSW 9 121,095,324 (GRCm39) missense possibly damaging 0.58
R1470:Ulk4 UTSW 9 120,910,722 (GRCm39) missense probably benign 0.00
R1470:Ulk4 UTSW 9 120,910,722 (GRCm39) missense probably benign 0.00
R1531:Ulk4 UTSW 9 120,873,841 (GRCm39) missense probably damaging 0.97
R1595:Ulk4 UTSW 9 120,873,904 (GRCm39) missense probably damaging 0.96
R1620:Ulk4 UTSW 9 121,033,871 (GRCm39) missense possibly damaging 0.81
R1835:Ulk4 UTSW 9 120,997,250 (GRCm39) missense probably null 1.00
R1966:Ulk4 UTSW 9 121,086,182 (GRCm39) missense probably benign
R2129:Ulk4 UTSW 9 120,981,248 (GRCm39) missense probably benign 0.03
R2329:Ulk4 UTSW 9 121,101,953 (GRCm39) missense probably damaging 1.00
R2877:Ulk4 UTSW 9 121,089,105 (GRCm39) missense probably benign 0.11
R2878:Ulk4 UTSW 9 121,089,105 (GRCm39) missense probably benign 0.11
R3734:Ulk4 UTSW 9 121,091,055 (GRCm39) missense probably benign 0.21
R3769:Ulk4 UTSW 9 121,092,766 (GRCm39) missense probably benign 0.00
R4005:Ulk4 UTSW 9 120,997,265 (GRCm39) missense possibly damaging 0.94
R4024:Ulk4 UTSW 9 120,873,915 (GRCm39) missense possibly damaging 0.86
R4321:Ulk4 UTSW 9 120,903,062 (GRCm39) missense probably benign 0.00
R4461:Ulk4 UTSW 9 120,985,950 (GRCm39) missense possibly damaging 0.83
R4537:Ulk4 UTSW 9 121,092,704 (GRCm39) nonsense probably null
R4542:Ulk4 UTSW 9 121,092,704 (GRCm39) nonsense probably null
R4572:Ulk4 UTSW 9 121,021,830 (GRCm39) missense probably damaging 1.00
R4647:Ulk4 UTSW 9 120,970,918 (GRCm39) missense probably benign 0.15
R4712:Ulk4 UTSW 9 121,073,436 (GRCm39) missense probably benign 0.23
R4730:Ulk4 UTSW 9 121,092,791 (GRCm39) missense probably benign 0.05
R4731:Ulk4 UTSW 9 121,092,704 (GRCm39) nonsense probably null
R4732:Ulk4 UTSW 9 121,092,704 (GRCm39) nonsense probably null
R4733:Ulk4 UTSW 9 121,092,704 (GRCm39) nonsense probably null
R4737:Ulk4 UTSW 9 120,902,938 (GRCm39) nonsense probably null
R4781:Ulk4 UTSW 9 120,932,642 (GRCm39) missense probably benign 0.00
R4860:Ulk4 UTSW 9 121,079,968 (GRCm39) missense possibly damaging 0.68
R4926:Ulk4 UTSW 9 121,087,798 (GRCm39) missense probably benign 0.00
R4990:Ulk4 UTSW 9 121,021,852 (GRCm39) missense probably benign 0.01
R6056:Ulk4 UTSW 9 121,102,021 (GRCm39) missense probably damaging 1.00
R6448:Ulk4 UTSW 9 120,932,696 (GRCm39) missense probably damaging 0.99
R6546:Ulk4 UTSW 9 120,970,960 (GRCm39) missense probably damaging 1.00
R6668:Ulk4 UTSW 9 121,017,408 (GRCm39) missense probably damaging 1.00
R6915:Ulk4 UTSW 9 121,087,886 (GRCm39) missense probably benign
R6929:Ulk4 UTSW 9 120,903,081 (GRCm39) missense probably benign 0.02
R7069:Ulk4 UTSW 9 121,095,583 (GRCm39) missense probably benign 0.25
R7069:Ulk4 UTSW 9 121,087,876 (GRCm39) missense probably benign 0.01
R7293:Ulk4 UTSW 9 121,084,190 (GRCm39) missense probably damaging 1.00
R7299:Ulk4 UTSW 9 120,974,125 (GRCm39) missense probably benign 0.32
R7301:Ulk4 UTSW 9 120,974,125 (GRCm39) missense probably benign 0.32
R7337:Ulk4 UTSW 9 121,077,993 (GRCm39) missense probably benign 0.44
R7395:Ulk4 UTSW 9 121,084,178 (GRCm39) missense probably benign
R7423:Ulk4 UTSW 9 120,932,687 (GRCm39) missense possibly damaging 0.48
R7545:Ulk4 UTSW 9 120,970,904 (GRCm39) missense probably benign 0.00
R7753:Ulk4 UTSW 9 121,095,578 (GRCm39) critical splice donor site probably null
R7791:Ulk4 UTSW 9 121,092,734 (GRCm39) missense possibly damaging 0.70
R7793:Ulk4 UTSW 9 121,092,734 (GRCm39) missense possibly damaging 0.70
R7834:Ulk4 UTSW 9 121,092,734 (GRCm39) missense possibly damaging 0.70
R7836:Ulk4 UTSW 9 120,873,885 (GRCm39) missense possibly damaging 0.72
R7960:Ulk4 UTSW 9 121,102,022 (GRCm39) missense probably damaging 1.00
R8087:Ulk4 UTSW 9 121,095,317 (GRCm39) missense probably damaging 0.99
R8203:Ulk4 UTSW 9 120,997,274 (GRCm39) missense probably damaging 0.96
R8246:Ulk4 UTSW 9 120,985,941 (GRCm39) makesense probably null
R8430:Ulk4 UTSW 9 121,086,144 (GRCm39) critical splice donor site probably null
R8841:Ulk4 UTSW 9 121,033,804 (GRCm39) missense probably damaging 1.00
R9014:Ulk4 UTSW 9 121,017,294 (GRCm39) missense probably benign 0.00
R9092:Ulk4 UTSW 9 120,903,003 (GRCm39) missense
R9126:Ulk4 UTSW 9 121,090,988 (GRCm39) missense probably damaging 0.99
R9176:Ulk4 UTSW 9 120,974,128 (GRCm39) missense probably benign
R9235:Ulk4 UTSW 9 120,981,217 (GRCm39) missense probably benign 0.13
R9713:Ulk4 UTSW 9 120,873,862 (GRCm39) nonsense probably null
X0024:Ulk4 UTSW 9 121,021,819 (GRCm39) missense probably damaging 1.00
X0066:Ulk4 UTSW 9 121,091,672 (GRCm39) missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- TGCCCACATTGTCCAAGACC -3'
(R):5'- TTCTGAGCCGTGACAGAACAAG -3'

Sequencing Primer
(F):5'- CAAGACCTCTTGTGCTGACAC -3'
(R):5'- CCCTGTGAGGCCTGAATTG -3'
Posted On 2019-11-26