Incidental Mutation 'R7790:Ulk4'
ID599822
Institutional Source Beutler Lab
Gene Symbol Ulk4
Ensembl Gene ENSMUSG00000040936
Gene Nameunc-51-like kinase 4
Synonyms4932415A06Rik
MMRRC Submission
Accession Numbers

Genbank: NM_177589; MGI: 1921622

Is this an essential gene? Possibly essential (E-score: 0.697) question?
Stock #R7790 (G1)
Quality Score225.009
Status Validated
Chromosome9
Chromosomal Location120955351-121277197 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) C to T at 121263668 bp
ZygosityHeterozygous
Amino Acid Change Glutamic Acid to Lysine at position 168 (E168K)
Ref Sequence ENSEMBL: ENSMUSP00000057960 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000051479] [ENSMUST00000051565] [ENSMUST00000171061] [ENSMUST00000171923]
Predicted Effect possibly damaging
Transcript: ENSMUST00000051479
AA Change: E168K

PolyPhen 2 Score 0.704 (Sensitivity: 0.86; Specificity: 0.92)
SMART Domains Protein: ENSMUSP00000057960
Gene: ENSMUSG00000040936
AA Change: E168K

DomainStartEndE-ValueType
Pfam:Pkinase_Tyr 4 277 9.9e-26 PFAM
Pfam:Pkinase 4 280 4.6e-49 PFAM
low complexity region 949 964 N/A INTRINSIC
low complexity region 968 985 N/A INTRINSIC
low complexity region 1107 1119 N/A INTRINSIC
low complexity region 1147 1161 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000051565
SMART Domains Protein: ENSMUSP00000054833
Gene: ENSMUSG00000040936

DomainStartEndE-ValueType
SCOP:d1jvpp_ 1 32 9e-6 SMART
Blast:S_TKc 4 45 2e-8 BLAST
Predicted Effect possibly damaging
Transcript: ENSMUST00000171061
AA Change: E168K

PolyPhen 2 Score 0.839 (Sensitivity: 0.84; Specificity: 0.93)
SMART Domains Protein: ENSMUSP00000129214
Gene: ENSMUSG00000040936
AA Change: E168K

DomainStartEndE-ValueType
Pfam:Pkinase_Tyr 4 277 4.3e-26 PFAM
Pfam:Pkinase 4 280 2.1e-49 PFAM
Predicted Effect possibly damaging
Transcript: ENSMUST00000171923
AA Change: E168K

PolyPhen 2 Score 0.930 (Sensitivity: 0.81; Specificity: 0.94)
SMART Domains Protein: ENSMUSP00000131342
Gene: ENSMUSG00000040936
AA Change: E168K

DomainStartEndE-ValueType
Pfam:Pkinase_Tyr 4 153 3.1e-14 PFAM
Pfam:Pkinase 4 280 4.9e-50 PFAM
Pfam:Pkinase_Tyr 165 277 6.1e-10 PFAM
low complexity region 949 964 N/A INTRINSIC
low complexity region 968 985 N/A INTRINSIC
low complexity region 1107 1119 N/A INTRINSIC
low complexity region 1147 1171 N/A INTRINSIC
Meta Mutation Damage Score 0.1629 question?
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.7%
  • 20x: 99.0%
Validation Efficiency 100% (81/81)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of the unc-51-like serine/threonine kinase (STK) family. Members of this protein family play a role in neuronal growth and endocytosis. The encoded protein is likely involved in neurite branching, neurite elongation and neuronal migration. Genome-wide association studies (GWAS) indicate an association of variations in this gene with blood pressure and hypertension. Sequence variations in this gene may also be be associated with psychiatric disorders, including schizophrenia and bipolar disorder. Pseudogenes associated with this gene have been identified and are located on chromosome 15. [provided by RefSeq, Jul 2016]
PHENOTYPE: Homozygotes for a null allele show reduced body size, hydrocephaly, dilated brain ventricles, otitis media, and premature death. Hypomorphic mice show partial corpus callosum aplasia, hydrocephaly, subcommissural organ and ependymal motile ciliary defects, aqueduct stenosis, and impaired CSF flow. [provided by MGI curators]
Allele List at MGI

All alleles(2) : Targeted, other(1) Gene trapped(1)

Other mutations in this stock
Total: 83 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700009N14Rik A T 4: 39,451,201 I136F possibly damaging Het
3110043O21Rik T C 4: 35,192,997 D444G unknown Het
4932415D10Rik C T 10: 82,287,495 C3227Y probably benign Het
Abca13 A T 11: 9,297,915 K2554M probably damaging Het
Ankrd12 C T 17: 65,984,230 D1403N possibly damaging Het
Ankrd17 A G 5: 90,260,152 V1402A possibly damaging Het
Ankrd36 A T 11: 5,635,176 N329I possibly damaging Het
Atr A T 9: 95,874,180 D815V probably damaging Het
Ceacam1 T C 7: 25,473,950 Y271C probably damaging Het
Cenpo T C 12: 4,214,597 H265R probably benign Het
Chd8 G A 14: 52,226,082 R702W probably damaging Het
Ckap5 A G 2: 91,559,110 N309S probably benign Het
Cxxc1 C T 18: 74,217,784 R83C probably damaging Het
Dcaf6 T C 1: 165,399,715 D281G probably damaging Het
Dennd4c A G 4: 86,799,517 T584A probably damaging Het
Dync2h1 G T 9: 7,114,914 H2415N probably damaging Het
Dzip1l A G 9: 99,660,962 E490G possibly damaging Het
Fam124a T C 14: 62,606,077 S345P probably benign Het
Fam83b G A 9: 76,492,048 T591I probably benign Het
Frem1 T C 4: 82,989,164 S838G probably benign Het
Fsip2 G T 2: 82,988,379 D4819Y probably benign Het
Gm43302 T G 5: 105,277,825 K246T probably benign Het
Gm5861 C A 5: 11,184,218 H30Q probably benign Het
Gml T C 15: 74,813,613 probably benign Het
Gpc1 A T 1: 92,853,449 H90L probably benign Het
Grik3 T C 4: 125,686,019 L519P probably damaging Het
Grwd1 A G 7: 45,826,014 V368A probably damaging Het
Gstm3 G A 3: 107,969,239 probably benign Het
Gtpbp6 A G 5: 110,104,386 S427P probably damaging Het
Heatr5b C T 17: 78,818,823 G560E probably damaging Het
Heatr9 A G 11: 83,518,193 V176A probably damaging Het
Hsf2bp A G 17: 32,034,479 V5A probably benign Het
Ints3 G T 3: 90,400,413 Q660K probably benign Het
Itpr2 A T 6: 146,224,776 L2048Q probably damaging Het
Kcnq1 G A 7: 143,106,605 probably null Het
Lsm12 A T 11: 102,165,169 probably null Het
Mcoln3 A G 3: 146,139,492 Y481C probably damaging Het
Meis3 A G 7: 16,182,397 N266D probably benign Het
Mgat5 G A 1: 127,412,204 E441K probably benign Het
Mroh6 C T 15: 75,884,240 R689H probably benign Het
Mtg1 T C 7: 140,149,749 Y251H probably damaging Het
Mtus2 A T 5: 148,078,188 Q597L probably benign Het
Myt1 A G 2: 181,797,597 E346G probably benign Het
Nat8f4 A G 6: 85,900,891 S217P probably benign Het
Ngf G A 3: 102,509,824 G17R unknown Het
Olfr863-ps1 A T 9: 19,941,684 M252K unknown Het
Pam T C 1: 97,821,847 Y968C probably damaging Het
Pcdhga7 T A 18: 37,714,943 M1K probably null Het
Pde8b G T 13: 95,034,171 D554E probably benign Het
Pdzd7 G A 19: 45,045,523 R41* probably null Het
Pkhd1l1 C T 15: 44,578,581 P3639S probably damaging Het
Plce1 A T 19: 38,780,696 E2280V probably damaging Het
Prrxl1 T A 14: 32,628,888 L227Q probably damaging Het
Ryr1 T C 7: 29,104,832 I538V probably benign Het
Scaf11 A G 15: 96,419,061 L874P possibly damaging Het
Scpep1 G T 11: 88,933,521 D307E possibly damaging Het
Sept4 A G 11: 87,589,239 E327G probably damaging Het
Skint2 T G 4: 112,616,554 V11G possibly damaging Het
Slc26a4 T C 12: 31,544,483 N289D probably damaging Het
Slc35f3 CTCTCTCTCTCTCTCTCTCTCTCTCTCTCTCTCTCTCTCTCTC CTCTCTCTCTCTCTCTCTCTCTCTCTCTCTCTCTCTCTCTCTCTC 8: 126,389,038 unknown Het
Slx4 T C 16: 3,986,982 E656G probably benign Het
Socs5 T C 17: 87,134,363 S244P probably benign Het
Stt3b A C 9: 115,276,819 L196R probably damaging Het
Syne2 T A 12: 75,929,103 probably null Het
Tab2 T A 10: 7,920,424 N24I probably damaging Het
Taf4b T C 18: 14,813,274 S385P probably damaging Het
Tg T C 15: 66,849,604 Y2720H probably damaging Het
Tjap1 C T 17: 46,258,690 G448E probably benign Het
Tll1 A T 8: 64,025,237 C827* probably null Het
Tlr11 T A 14: 50,361,925 I456K probably benign Het
Tmem209 T C 6: 30,497,855 D305G probably damaging Het
Tmem82 A T 4: 141,617,724 probably null Het
Tnfrsf14 A G 4: 154,923,293 V207A probably benign Het
Tnks A T 8: 34,861,540 N625K probably benign Het
Tomm20 G A 8: 126,939,950 P58S possibly damaging Het
Ttc9b A G 7: 27,654,336 D137G probably benign Het
Usp9y T A Y: 1,444,573 D122V probably damaging Het
Vps41 C A 13: 18,842,268 T512K possibly damaging Het
Wdr49 T A 3: 75,275,028 N698I probably benign Het
Zfp568 G A 7: 30,022,725 C365Y probably damaging Het
Zfp663 A T 2: 165,352,533 C589S probably damaging Het
Zfp971 A G 2: 178,033,499 K297R probably damaging Het
Zkscan16 G T 4: 58,951,843 E173* probably null Het
Other mutations in Ulk4
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01122:Ulk4 APN 9 121168292 missense possibly damaging 0.48
IGL01345:Ulk4 APN 9 121208162 missense possibly damaging 0.48
IGL01432:Ulk4 APN 9 121266301 missense probably damaging 1.00
IGL01807:Ulk4 APN 9 121255185 missense probably damaging 1.00
IGL02139:Ulk4 APN 9 121141831 splice site probably null
IGL02266:Ulk4 APN 9 121081700 missense probably benign 0.10
IGL02511:Ulk4 APN 9 121188354 missense probably damaging 1.00
IGL02546:Ulk4 APN 9 121152307 nonsense probably null
IGL02687:Ulk4 APN 9 121192662 missense possibly damaging 0.89
IGL03220:Ulk4 APN 9 121145336 missense probably damaging 1.00
3-1:Ulk4 UTSW 9 121255171 missense probably benign 0.02
R0031:Ulk4 UTSW 9 121272982 missense probably damaging 1.00
R0433:Ulk4 UTSW 9 121044819 missense probably benign 0.27
R0513:Ulk4 UTSW 9 121152325 missense probably benign 0.13
R0524:Ulk4 UTSW 9 121252651 critical splice donor site probably null
R1268:Ulk4 UTSW 9 121257074 splice site probably benign
R1439:Ulk4 UTSW 9 121266258 missense possibly damaging 0.58
R1470:Ulk4 UTSW 9 121081656 missense probably benign 0.00
R1470:Ulk4 UTSW 9 121081656 missense probably benign 0.00
R1531:Ulk4 UTSW 9 121044775 missense probably damaging 0.97
R1595:Ulk4 UTSW 9 121044838 missense probably damaging 0.96
R1620:Ulk4 UTSW 9 121204805 missense possibly damaging 0.81
R1835:Ulk4 UTSW 9 121168184 missense probably null 1.00
R1966:Ulk4 UTSW 9 121257116 missense probably benign
R2129:Ulk4 UTSW 9 121152182 missense probably benign 0.03
R2329:Ulk4 UTSW 9 121272887 missense probably damaging 1.00
R2877:Ulk4 UTSW 9 121260039 missense probably benign 0.11
R2878:Ulk4 UTSW 9 121260039 missense probably benign 0.11
R3734:Ulk4 UTSW 9 121261989 missense probably benign 0.21
R3769:Ulk4 UTSW 9 121263700 missense probably benign 0.00
R4005:Ulk4 UTSW 9 121168199 missense possibly damaging 0.94
R4024:Ulk4 UTSW 9 121044849 missense possibly damaging 0.86
R4321:Ulk4 UTSW 9 121073996 missense probably benign 0.00
R4461:Ulk4 UTSW 9 121156884 missense possibly damaging 0.83
R4537:Ulk4 UTSW 9 121263638 nonsense probably null
R4542:Ulk4 UTSW 9 121263638 nonsense probably null
R4572:Ulk4 UTSW 9 121192764 missense probably damaging 1.00
R4647:Ulk4 UTSW 9 121141852 missense probably benign 0.15
R4712:Ulk4 UTSW 9 121244370 missense probably benign 0.23
R4730:Ulk4 UTSW 9 121263725 missense probably benign 0.05
R4731:Ulk4 UTSW 9 121263638 nonsense probably null
R4732:Ulk4 UTSW 9 121263638 nonsense probably null
R4733:Ulk4 UTSW 9 121263638 nonsense probably null
R4737:Ulk4 UTSW 9 121073872 nonsense probably null
R4781:Ulk4 UTSW 9 121103576 missense probably benign 0.00
R4860:Ulk4 UTSW 9 121250902 missense possibly damaging 0.68
R4926:Ulk4 UTSW 9 121258732 missense probably benign 0.00
R4990:Ulk4 UTSW 9 121192786 missense probably benign 0.01
R6056:Ulk4 UTSW 9 121272955 missense probably damaging 1.00
R6448:Ulk4 UTSW 9 121103630 missense probably damaging 0.99
R6546:Ulk4 UTSW 9 121141894 missense probably damaging 1.00
R6668:Ulk4 UTSW 9 121188342 missense probably damaging 1.00
R6915:Ulk4 UTSW 9 121258820 missense probably benign
R6929:Ulk4 UTSW 9 121074015 missense probably benign 0.02
R7069:Ulk4 UTSW 9 121258810 missense probably benign 0.01
R7069:Ulk4 UTSW 9 121266517 missense probably benign 0.25
R7293:Ulk4 UTSW 9 121255124 missense probably damaging 1.00
R7299:Ulk4 UTSW 9 121145059 missense probably benign 0.32
R7301:Ulk4 UTSW 9 121145059 missense probably benign 0.32
R7337:Ulk4 UTSW 9 121248927 missense probably benign 0.44
R7395:Ulk4 UTSW 9 121255112 missense probably benign
R7423:Ulk4 UTSW 9 121103621 missense possibly damaging 0.48
R7545:Ulk4 UTSW 9 121141838 missense probably benign 0.00
R7753:Ulk4 UTSW 9 121266512 critical splice donor site probably null
R7791:Ulk4 UTSW 9 121263668 missense possibly damaging 0.70
R7793:Ulk4 UTSW 9 121263668 missense possibly damaging 0.70
R7834:Ulk4 UTSW 9 121263668 missense possibly damaging 0.70
R7836:Ulk4 UTSW 9 121044819 missense possibly damaging 0.72
R7960:Ulk4 UTSW 9 121272956 missense probably damaging 1.00
R8087:Ulk4 UTSW 9 121266251 missense probably damaging 0.99
R8203:Ulk4 UTSW 9 121168208 missense probably damaging 0.96
R8246:Ulk4 UTSW 9 121156875 makesense probably null
R8430:Ulk4 UTSW 9 121257078 critical splice donor site probably null
X0024:Ulk4 UTSW 9 121192753 missense probably damaging 1.00
X0066:Ulk4 UTSW 9 121262606 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- TGCCCACATTGTCCAAGACC -3'
(R):5'- TTCTGAGCCGTGACAGAACAAG -3'

Sequencing Primer
(F):5'- CAAGACCTCTTGTGCTGACAC -3'
(R):5'- CCCTGTGAGGCCTGAATTG -3'
Posted On2019-11-26