Incidental Mutation 'R7790:Vps41'
ID599832
Institutional Source Beutler Lab
Gene Symbol Vps41
Ensembl Gene ENSMUSG00000041236
Gene NameVPS41 HOPS complex subunit
SynonymsVam2, mVam2
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R7790 (G1)
Quality Score225.009
Status Not validated
Chromosome13
Chromosomal Location18717286-18866811 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) C to A at 18842268 bp
ZygosityHeterozygous
Amino Acid Change Threonine to Lysine at position 512 (T512K)
Ref Sequence ENSEMBL: ENSMUSP00000072729 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000072961]
Predicted Effect possibly damaging
Transcript: ENSMUST00000072961
AA Change: T512K

PolyPhen 2 Score 0.759 (Sensitivity: 0.85; Specificity: 0.92)
SMART Domains Protein: ENSMUSP00000072729
Gene: ENSMUSG00000041236
AA Change: T512K

DomainStartEndE-ValueType
low complexity region 3 26 N/A INTRINSIC
Blast:WD40 34 70 2e-7 BLAST
SCOP:d1flga_ 44 253 6e-9 SMART
Blast:WD40 159 195 3e-11 BLAST
CLH 570 711 1.92e-42 SMART
RING 790 837 8.98e-2 SMART
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.7%
  • 20x: 99.0%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] Vesicle mediated protein sorting plays an important role in segregation of intracellular molecules into distinct organelles. Genetic studies in yeast have identified more than 40 vacuolar protein sorting (VPS) genes involved in vesicle transport to vacuoles. This gene encodes the human ortholog of yeast Vps41 protein which is also conserved in Drosophila, tomato, and Arabidopsis. Expression studies in yeast and human indicate that this protein may be involved in the formation and fusion of transport vesicles from the Golgi. Several transcript variants encoding different isoforms have been described for this gene, however, the full-length nature of not all is known. [provided by RefSeq, Jul 2008]
PHENOTYPE: Embryos homozygous for a knock-out allele die by E9 exhibiting morphological and functional alteration of late endocytic compartments, and abnormal triploblastic development. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 79 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700009N14Rik A T 4: 39,451,201 I136F possibly damaging Het
3110043O21Rik T C 4: 35,192,997 D444G unknown Het
4932415D10Rik C T 10: 82,287,495 C3227Y probably benign Het
Abca13 A T 11: 9,297,915 K2554M probably damaging Het
Ankrd12 C T 17: 65,984,230 D1403N possibly damaging Het
Ankrd17 A G 5: 90,260,152 V1402A possibly damaging Het
Ankrd36 A T 11: 5,635,176 N329I possibly damaging Het
Atr A T 9: 95,874,180 D815V probably damaging Het
Ceacam1 T C 7: 25,473,950 Y271C probably damaging Het
Cenpo T C 12: 4,214,597 H265R probably benign Het
Chd8 G A 14: 52,226,082 R702W probably damaging Het
Ckap5 A G 2: 91,559,110 N309S probably benign Het
Cxxc1 C T 18: 74,217,784 R83C probably damaging Het
Dcaf6 T C 1: 165,399,715 D281G probably damaging Het
Dennd4c A G 4: 86,799,517 T584A probably damaging Het
Dync2h1 G T 9: 7,114,914 H2415N probably damaging Het
Dzip1l A G 9: 99,660,962 E490G possibly damaging Het
Fam124a T C 14: 62,606,077 S345P probably benign Het
Fam83b G A 9: 76,492,048 T591I probably benign Het
Frem1 T C 4: 82,989,164 S838G probably benign Het
Fsip2 G T 2: 82,988,379 D4819Y probably benign Het
Gm43302 T G 5: 105,277,825 K246T probably benign Het
Gm5861 C A 5: 11,184,218 H30Q probably benign Het
Gml T C 15: 74,813,613 probably benign Het
Gpc1 A T 1: 92,853,449 H90L probably benign Het
Grik3 T C 4: 125,686,019 L519P probably damaging Het
Grwd1 A G 7: 45,826,014 V368A probably damaging Het
Gstm3 G A 3: 107,969,239 probably benign Het
Gtpbp6 A G 5: 110,104,386 S427P probably damaging Het
Heatr5b C T 17: 78,818,823 G560E probably damaging Het
Heatr9 A G 11: 83,518,193 V176A probably damaging Het
Hsf2bp A G 17: 32,034,479 V5A probably benign Het
Ints3 G T 3: 90,400,413 Q660K probably benign Het
Itpr2 A T 6: 146,224,776 L2048Q probably damaging Het
Mcoln3 A G 3: 146,139,492 Y481C probably damaging Het
Meis3 A G 7: 16,182,397 N266D probably benign Het
Mgat5 G A 1: 127,412,204 E441K probably benign Het
Mroh6 C T 15: 75,884,240 R689H probably benign Het
Mtg1 T C 7: 140,149,749 Y251H probably damaging Het
Mtus2 A T 5: 148,078,188 Q597L probably benign Het
Myt1 A G 2: 181,797,597 E346G probably benign Het
Nat8f4 A G 6: 85,900,891 S217P probably benign Het
Ngf G A 3: 102,509,824 G17R unknown Het
Olfr863-ps1 A T 9: 19,941,684 M252K unknown Het
Pam T C 1: 97,821,847 Y968C probably damaging Het
Pcdhga7 T A 18: 37,714,943 M1K probably null Het
Pde8b G T 13: 95,034,171 D554E probably benign Het
Pdzd7 G A 19: 45,045,523 R41* probably null Het
Pkhd1l1 C T 15: 44,578,581 P3639S probably damaging Het
Plce1 A T 19: 38,780,696 E2280V probably damaging Het
Prrxl1 T A 14: 32,628,888 L227Q probably damaging Het
Ryr1 T C 7: 29,104,832 I538V probably benign Het
Scaf11 A G 15: 96,419,061 L874P possibly damaging Het
Scpep1 G T 11: 88,933,521 D307E possibly damaging Het
Sept4 A G 11: 87,589,239 E327G probably damaging Het
Skint2 T G 4: 112,616,554 V11G possibly damaging Het
Slc26a4 T C 12: 31,544,483 N289D probably damaging Het
Slc35f3 CTCTCTCTCTCTCTCTCTCTCTCTCTCTCTCTCTCTCTCTCTC CTCTCTCTCTCTCTCTCTCTCTCTCTCTCTCTCTCTCTCTCTCTC 8: 126,389,038 unknown Het
Slx4 T C 16: 3,986,982 E656G probably benign Het
Socs5 T C 17: 87,134,363 S244P probably benign Het
Stt3b A C 9: 115,276,819 L196R probably damaging Het
Tab2 T A 10: 7,920,424 N24I probably damaging Het
Taf4b T C 18: 14,813,274 S385P probably damaging Het
Tg T C 15: 66,849,604 Y2720H probably damaging Het
Tjap1 C T 17: 46,258,690 G448E probably benign Het
Tll1 A T 8: 64,025,237 C827* probably null Het
Tlr11 T A 14: 50,361,925 I456K probably benign Het
Tmem209 T C 6: 30,497,855 D305G probably damaging Het
Tnfrsf14 A G 4: 154,923,293 V207A probably benign Het
Tnks A T 8: 34,861,540 N625K probably benign Het
Tomm20 G A 8: 126,939,950 P58S possibly damaging Het
Ttc9b A G 7: 27,654,336 D137G probably benign Het
Ulk4 C T 9: 121,263,668 E168K possibly damaging Het
Usp9y T A Y: 1,444,573 D122V probably damaging Het
Wdr49 T A 3: 75,275,028 N698I probably benign Het
Zfp568 G A 7: 30,022,725 C365Y probably damaging Het
Zfp663 A T 2: 165,352,533 C589S probably damaging Het
Zfp971 A G 2: 178,033,499 K297R probably damaging Het
Zkscan16 G T 4: 58,951,843 E173* probably null Het
Other mutations in Vps41
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01134:Vps41 APN 13 18866150 missense probably benign 0.37
IGL01563:Vps41 APN 13 18782727 splice site probably benign
IGL01880:Vps41 APN 13 18810471 missense probably benign 0.01
IGL02024:Vps41 APN 13 18791657 splice site probably benign
IGL02458:Vps41 APN 13 18853479 missense possibly damaging 0.67
IGL02740:Vps41 APN 13 18838680 missense probably damaging 1.00
IGL03218:Vps41 APN 13 18829270 missense possibly damaging 0.74
R0197:Vps41 UTSW 13 18854663 critical splice donor site probably null
R0284:Vps41 UTSW 13 18853440 missense probably damaging 1.00
R0321:Vps41 UTSW 13 18842295 splice site probably benign
R0372:Vps41 UTSW 13 18842247 missense probably benign 0.00
R0382:Vps41 UTSW 13 18827727 missense probably benign 0.30
R1691:Vps41 UTSW 13 18841243 missense probably damaging 1.00
R2055:Vps41 UTSW 13 18854616 missense possibly damaging 0.95
R2082:Vps41 UTSW 13 18852351 missense probably benign 0.27
R2147:Vps41 UTSW 13 18839734 splice site probably null
R2897:Vps41 UTSW 13 18810428 splice site probably benign
R4322:Vps41 UTSW 13 18823790 missense probably damaging 1.00
R4600:Vps41 UTSW 13 18745283 missense probably damaging 0.97
R4751:Vps41 UTSW 13 18811622 missense probably damaging 0.98
R4856:Vps41 UTSW 13 18829255 missense probably damaging 0.98
R5389:Vps41 UTSW 13 18862538 missense probably damaging 0.99
R7022:Vps41 UTSW 13 18842268 missense possibly damaging 0.76
R7456:Vps41 UTSW 13 18864034 missense probably benign 0.02
R7747:Vps41 UTSW 13 18841252 critical splice donor site probably null
R8029:Vps41 UTSW 13 18823785 nonsense probably null
R8033:Vps41 UTSW 13 18810465 missense possibly damaging 0.94
Z1177:Vps41 UTSW 13 18845935 missense probably benign 0.00
Z1177:Vps41 UTSW 13 18854595 missense probably damaging 0.97
Predicted Primers PCR Primer
(F):5'- TATCCTTTAATGGCCTGCACTG -3'
(R):5'- ACACCATTCCTCTGGCAGAC -3'

Sequencing Primer
(F):5'- GCAGATTGAAACCCAGCTGTG -3'
(R):5'- TGGCAGACAGATCTCACTATAATGC -3'
Posted On2019-11-26