Incidental Mutation 'R7790:Tg'
ID 599839
Institutional Source Beutler Lab
Gene Symbol Tg
Ensembl Gene ENSMUSG00000053469
Gene Name thyroglobulin
Synonyms Tgn
MMRRC Submission 045846-MU
Accession Numbers
Essential gene? Probably non essential (E-score: 0.096) question?
Stock # R7790 (G1)
Quality Score 225.009
Status Validated
Chromosome 15
Chromosomal Location 66542606-66722570 bp(+) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) T to C at 66721453 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Tyrosine to Histidine at position 2720 (Y2720H)
Ref Sequence ENSEMBL: ENSMUSP00000070239 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000065916] [ENSMUST00000166403] [ENSMUST00000171045]
AlphaFold no structure available at present
Predicted Effect probably damaging
Transcript: ENSMUST00000065916
AA Change: Y2720H

PolyPhen 2 Score 0.991 (Sensitivity: 0.71; Specificity: 0.97)
SMART Domains Protein: ENSMUSP00000070239
Gene: ENSMUSG00000053469
AA Change: Y2720H

DomainStartEndE-ValueType
signal peptide 1 20 N/A INTRINSIC
TY 50 97 5.9e-16 SMART
TY 118 165 5.59e-17 SMART
Pfam:Thyroglobulin_1 174 252 4e-9 PFAM
TY 317 363 4.36e-19 SMART
low complexity region 495 504 N/A INTRINSIC
TY 617 662 3.58e-15 SMART
TY 684 730 1.47e-16 SMART
TY 880 926 1.51e-4 SMART
TY 1029 1078 1.21e-12 SMART
TY 1106 1150 7.56e-5 SMART
TY 1167 1215 7.26e-16 SMART
low complexity region 1244 1255 N/A INTRINSIC
Pfam:GCC2_GCC3 1464 1509 2.7e-16 PFAM
TY 1519 1568 9.81e-13 SMART
Pfam:COesterase 2181 2717 8.4e-140 PFAM
Predicted Effect possibly damaging
Transcript: ENSMUST00000166403
AA Change: Y321H

PolyPhen 2 Score 0.903 (Sensitivity: 0.82; Specificity: 0.94)
Predicted Effect probably damaging
Transcript: ENSMUST00000171045
AA Change: Y1101H

PolyPhen 2 Score 0.991 (Sensitivity: 0.71; Specificity: 0.97)
SMART Domains Protein: ENSMUSP00000126454
Gene: ENSMUSG00000053469
AA Change: Y1101H

DomainStartEndE-ValueType
internal_repeat_1 93 331 1.53e-6 PROSPERO
Pfam:COesterase 562 1098 2.1e-137 PFAM
Meta Mutation Damage Score 0.1047 question?
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.7%
  • 20x: 99.0%
Validation Efficiency 100% (81/81)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] Thyroglobulin (Tg) is a glycoprotein homodimer produced predominantly by the thryroid gland. It acts as a substrate for the synthesis of thyroxine and triiodothyronine as well as the storage of the inactive forms of thyroid hormone and iodine. Thyroglobulin is secreted from the endoplasmic reticulum to its site of iodination, and subsequent thyroxine biosynthesis, in the follicular lumen. Mutations in this gene cause thyroid dyshormonogenesis, manifested as goiter, and are associated with moderate to severe congenital hypothyroidism. Polymorphisms in this gene are associated with susceptibility to autoimmune thyroid diseases (AITD) such as Graves disease and Hashimoto thryoiditis. [provided by RefSeq, Nov 2009]
PHENOTYPE: Mice homozygous for a spontaneous mutation exhibit enlarged thyroid gland, hypothyroidism, abnormal thyroid gland morphology, and decreased body weight. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 83 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700009N14Rik A T 4: 39,451,201 (GRCm39) I136F possibly damaging Het
Abca13 A T 11: 9,247,915 (GRCm39) K2554M probably damaging Het
Ankrd12 C T 17: 66,291,225 (GRCm39) D1403N possibly damaging Het
Ankrd17 A G 5: 90,408,011 (GRCm39) V1402A possibly damaging Het
Ankrd36 A T 11: 5,585,176 (GRCm39) N329I possibly damaging Het
Atr A T 9: 95,756,233 (GRCm39) D815V probably damaging Het
C9orf72 T C 4: 35,192,997 (GRCm39) D444G unknown Het
Ceacam1 T C 7: 25,173,375 (GRCm39) Y271C probably damaging Het
Cenpo T C 12: 4,264,597 (GRCm39) H265R probably benign Het
Chd8 G A 14: 52,463,539 (GRCm39) R702W probably damaging Het
Ckap5 A G 2: 91,389,455 (GRCm39) N309S probably benign Het
Cxxc1 C T 18: 74,350,855 (GRCm39) R83C probably damaging Het
Dcaf6 T C 1: 165,227,284 (GRCm39) D281G probably damaging Het
Dennd4c A G 4: 86,717,754 (GRCm39) T584A probably damaging Het
Drgx T A 14: 32,350,845 (GRCm39) L227Q probably damaging Het
Dync2h1 G T 9: 7,114,914 (GRCm39) H2415N probably damaging Het
Dzip1l A G 9: 99,543,015 (GRCm39) E490G possibly damaging Het
Fam124a T C 14: 62,843,526 (GRCm39) S345P probably benign Het
Fam83b G A 9: 76,399,330 (GRCm39) T591I probably benign Het
Frem1 T C 4: 82,907,401 (GRCm39) S838G probably benign Het
Fsip2 G T 2: 82,818,723 (GRCm39) D4819Y probably benign Het
Gm43302 T G 5: 105,425,691 (GRCm39) K246T probably benign Het
Gml T C 15: 74,685,462 (GRCm39) probably benign Het
Gpc1 A T 1: 92,781,171 (GRCm39) H90L probably benign Het
Grik3 T C 4: 125,579,812 (GRCm39) L519P probably damaging Het
Grwd1 A G 7: 45,475,438 (GRCm39) V368A probably damaging Het
Gstm3 G A 3: 107,876,555 (GRCm39) probably benign Het
Gtpbp6 A G 5: 110,252,252 (GRCm39) S427P probably damaging Het
Heatr5b C T 17: 79,126,252 (GRCm39) G560E probably damaging Het
Heatr9 A G 11: 83,409,019 (GRCm39) V176A probably damaging Het
Hsf2bp A G 17: 32,253,453 (GRCm39) V5A probably benign Het
Ints3 G T 3: 90,307,720 (GRCm39) Q660K probably benign Het
Itpr2 A T 6: 146,126,274 (GRCm39) L2048Q probably damaging Het
Kcnq1 G A 7: 142,660,342 (GRCm39) probably null Het
Lsm12 A T 11: 102,055,995 (GRCm39) probably null Het
Mcoln3 A G 3: 145,845,247 (GRCm39) Y481C probably damaging Het
Meis3 A G 7: 15,916,322 (GRCm39) N266D probably benign Het
Mgat5 G A 1: 127,339,941 (GRCm39) E441K probably benign Het
Mroh6 C T 15: 75,756,089 (GRCm39) R689H probably benign Het
Mtg1 T C 7: 139,729,662 (GRCm39) Y251H probably damaging Het
Mtus2 A T 5: 148,014,998 (GRCm39) Q597L probably benign Het
Myt1 A G 2: 181,439,390 (GRCm39) E346G probably benign Het
Nat8f4 A G 6: 85,877,873 (GRCm39) S217P probably benign Het
Ngf G A 3: 102,417,140 (GRCm39) G17R unknown Het
Or7e171-ps1 A T 9: 19,852,980 (GRCm39) M252K unknown Het
Pam T C 1: 97,749,572 (GRCm39) Y968C probably damaging Het
Pcdhga7 T A 18: 37,847,996 (GRCm39) M1K probably null Het
Pde8b G T 13: 95,170,679 (GRCm39) D554E probably benign Het
Pdzd7 G A 19: 45,033,962 (GRCm39) R41* probably null Het
Pkhd1l1 C T 15: 44,441,977 (GRCm39) P3639S probably damaging Het
Plce1 A T 19: 38,769,140 (GRCm39) E2280V probably damaging Het
Ryr1 T C 7: 28,804,257 (GRCm39) I538V probably benign Het
Scaf11 A G 15: 96,316,942 (GRCm39) L874P possibly damaging Het
Scpep1 G T 11: 88,824,347 (GRCm39) D307E possibly damaging Het
Septin4 A G 11: 87,480,065 (GRCm39) E327G probably damaging Het
Skint2 T G 4: 112,473,751 (GRCm39) V11G possibly damaging Het
Slc26a4 T C 12: 31,594,482 (GRCm39) N289D probably damaging Het
Slc35f3 CTCTCTCTCTCTCTCTCTCTCTCTCTCTCTCTCTCTCTCTCTC CTCTCTCTCTCTCTCTCTCTCTCTCTCTCTCTCTCTCTCTCTCTC 8: 127,115,777 (GRCm39) probably benign Het
Slx4 T C 16: 3,804,846 (GRCm39) E656G probably benign Het
Socs5 T C 17: 87,441,791 (GRCm39) S244P probably benign Het
Spata31h1 C T 10: 82,123,329 (GRCm39) C3227Y probably benign Het
Speer1e C A 5: 11,234,185 (GRCm39) H30Q probably benign Het
Stt3b A C 9: 115,105,887 (GRCm39) L196R probably damaging Het
Syne2 T A 12: 75,975,877 (GRCm39) probably null Het
Tab2 T A 10: 7,796,188 (GRCm39) N24I probably damaging Het
Taf4b T C 18: 14,946,331 (GRCm39) S385P probably damaging Het
Tjap1 C T 17: 46,569,616 (GRCm39) G448E probably benign Het
Tll1 A T 8: 64,478,271 (GRCm39) C827* probably null Het
Tlr11 T A 14: 50,599,382 (GRCm39) I456K probably benign Het
Tmem209 T C 6: 30,497,854 (GRCm39) D305G probably damaging Het
Tmem82 A T 4: 141,345,035 (GRCm39) probably null Het
Tnfrsf14 A G 4: 155,007,750 (GRCm39) V207A probably benign Het
Tnks A T 8: 35,328,694 (GRCm39) N625K probably benign Het
Tomm20 G A 8: 127,666,700 (GRCm39) P58S possibly damaging Het
Ttc9b A G 7: 27,353,761 (GRCm39) D137G probably benign Het
Ulk4 C T 9: 121,092,734 (GRCm39) E168K possibly damaging Het
Usp9y T A Y: 1,444,573 (GRCm39) D122V probably damaging Het
Vps41 C A 13: 19,026,438 (GRCm39) T512K possibly damaging Het
Wdr49 T A 3: 75,182,335 (GRCm39) N698I probably benign Het
Zfp568 G A 7: 29,722,150 (GRCm39) C365Y probably damaging Het
Zfp663 A T 2: 165,194,453 (GRCm39) C589S probably damaging Het
Zfp971 A G 2: 177,675,292 (GRCm39) K297R probably damaging Het
Zkscan16 G T 4: 58,951,843 (GRCm39) E173* probably null Het
Other mutations in Tg
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00157:Tg APN 15 66,719,015 (GRCm39) missense probably damaging 1.00
IGL00230:Tg APN 15 66,699,139 (GRCm39) missense probably benign 0.00
IGL00324:Tg APN 15 66,565,273 (GRCm39) missense probably benign
IGL00428:Tg APN 15 66,645,273 (GRCm39) missense probably benign 0.33
IGL00703:Tg APN 15 66,568,338 (GRCm39) missense probably benign 0.34
IGL00808:Tg APN 15 66,555,662 (GRCm39) missense probably damaging 1.00
IGL00833:Tg APN 15 66,560,650 (GRCm39) missense probably benign 0.34
IGL00899:Tg APN 15 66,545,922 (GRCm39) critical splice donor site probably null
IGL00921:Tg APN 15 66,636,302 (GRCm39) missense probably benign 0.28
IGL00975:Tg APN 15 66,553,731 (GRCm39) missense probably benign
IGL01288:Tg APN 15 66,608,125 (GRCm39) missense possibly damaging 0.81
IGL01397:Tg APN 15 66,567,941 (GRCm39) splice site probably benign
IGL01634:Tg APN 15 66,601,415 (GRCm39) missense probably benign 0.34
IGL01646:Tg APN 15 66,549,936 (GRCm39) missense probably damaging 1.00
IGL01704:Tg APN 15 66,543,200 (GRCm39) missense probably damaging 0.98
IGL01958:Tg APN 15 66,631,335 (GRCm39) missense probably benign 0.06
IGL02093:Tg APN 15 66,564,223 (GRCm39) missense possibly damaging 0.83
IGL02113:Tg APN 15 66,577,179 (GRCm39) missense probably benign 0.08
IGL02138:Tg APN 15 66,589,082 (GRCm39) missense probably benign 0.01
IGL02156:Tg APN 15 66,577,197 (GRCm39) missense probably benign 0.19
IGL02169:Tg APN 15 66,629,792 (GRCm39) missense probably benign 0.04
IGL02342:Tg APN 15 66,636,140 (GRCm39) missense probably benign
IGL02434:Tg APN 15 66,636,191 (GRCm39) missense probably damaging 0.97
IGL02506:Tg APN 15 66,613,443 (GRCm39) missense possibly damaging 0.71
IGL02513:Tg APN 15 66,577,123 (GRCm39) missense probably benign
IGL02549:Tg APN 15 66,711,210 (GRCm39) missense probably damaging 1.00
IGL02669:Tg APN 15 66,620,575 (GRCm39) splice site probably benign
IGL02756:Tg APN 15 66,606,435 (GRCm39) missense probably benign
IGL02800:Tg APN 15 66,629,735 (GRCm39) missense probably damaging 1.00
IGL02828:Tg APN 15 66,554,243 (GRCm39) missense probably damaging 1.00
IGL02927:Tg APN 15 66,549,942 (GRCm39) missense probably damaging 1.00
IGL03061:Tg APN 15 66,543,254 (GRCm39) missense probably damaging 1.00
IGL03105:Tg APN 15 66,586,955 (GRCm39) missense probably benign 0.01
IGL03160:Tg APN 15 66,711,152 (GRCm39) nonsense probably null
IGL03242:Tg APN 15 66,555,647 (GRCm39) missense probably damaging 0.99
Also_ran UTSW 15 66,550,688 (GRCm39) missense probably damaging 1.00
bedraggled UTSW 15 66,612,563 (GRCm39) missense probably damaging 1.00
foster UTSW 15 66,565,109 (GRCm39) nonsense probably null
hognose UTSW 15 66,589,057 (GRCm39) missense probably damaging 0.99
ito UTSW 15 66,638,011 (GRCm39) nonsense probably null
ito2 UTSW 15 66,543,245 (GRCm39) missense probably damaging 1.00
ito3 UTSW 15 66,645,323 (GRCm39) missense probably damaging 1.00
ito4 UTSW 15 66,568,369 (GRCm39) missense possibly damaging 0.47
Papua UTSW 15 66,545,899 (GRCm39) missense probably damaging 1.00
Pipistrella UTSW 15 66,567,984 (GRCm39) missense probably damaging 1.00
pluribus UTSW 15 66,587,012 (GRCm39) missense probably damaging 0.98
samarai UTSW 15 66,629,855 (GRCm39) critical splice donor site probably null
sariba UTSW 15 66,566,719 (GRCm39) missense probably benign 0.01
ticker UTSW 15 66,699,231 (GRCm39) nonsense probably null
Vampire UTSW 15 66,554,676 (GRCm39) missense probably damaging 1.00
IGL03134:Tg UTSW 15 66,612,567 (GRCm39) missense probably damaging 1.00
P0019:Tg UTSW 15 66,560,712 (GRCm39) missense probably benign 0.01
R0121:Tg UTSW 15 66,612,630 (GRCm39) missense probably benign 0.04
R0135:Tg UTSW 15 66,566,719 (GRCm39) missense probably benign 0.01
R0227:Tg UTSW 15 66,570,295 (GRCm39) missense possibly damaging 0.84
R0448:Tg UTSW 15 66,636,291 (GRCm39) missense probably damaging 1.00
R0453:Tg UTSW 15 66,700,382 (GRCm39) missense probably benign 0.09
R0504:Tg UTSW 15 66,554,253 (GRCm39) missense probably damaging 0.97
R0543:Tg UTSW 15 66,601,446 (GRCm39) missense probably benign 0.13
R0638:Tg UTSW 15 66,589,057 (GRCm39) missense probably damaging 0.99
R0639:Tg UTSW 15 66,613,333 (GRCm39) critical splice acceptor site probably null
R0646:Tg UTSW 15 66,601,475 (GRCm39) missense probably damaging 0.99
R0666:Tg UTSW 15 66,609,370 (GRCm39) missense probably benign
R0673:Tg UTSW 15 66,613,333 (GRCm39) critical splice acceptor site probably null
R0689:Tg UTSW 15 66,711,253 (GRCm39) splice site probably benign
R0704:Tg UTSW 15 66,629,729 (GRCm39) missense probably benign 0.02
R0730:Tg UTSW 15 66,550,638 (GRCm39) missense probably damaging 1.00
R0830:Tg UTSW 15 66,596,993 (GRCm39) missense probably damaging 1.00
R0959:Tg UTSW 15 66,579,859 (GRCm39) missense probably damaging 0.98
R1027:Tg UTSW 15 66,544,258 (GRCm39) missense possibly damaging 0.65
R1061:Tg UTSW 15 66,570,408 (GRCm39) missense probably benign 0.09
R1086:Tg UTSW 15 66,555,911 (GRCm39) missense probably benign
R1103:Tg UTSW 15 66,591,504 (GRCm39) missense probably benign 0.45
R1240:Tg UTSW 15 66,700,397 (GRCm39) missense probably benign 0.16
R1281:Tg UTSW 15 66,568,338 (GRCm39) missense probably benign 0.34
R1470:Tg UTSW 15 66,721,312 (GRCm39) missense possibly damaging 0.95
R1470:Tg UTSW 15 66,721,312 (GRCm39) missense possibly damaging 0.95
R1531:Tg UTSW 15 66,722,351 (GRCm39) missense probably benign 0.02
R1544:Tg UTSW 15 66,577,081 (GRCm39) missense probably benign 0.04
R1550:Tg UTSW 15 66,565,279 (GRCm39) missense possibly damaging 0.52
R1575:Tg UTSW 15 66,601,534 (GRCm39) critical splice donor site probably null
R1638:Tg UTSW 15 66,568,015 (GRCm39) nonsense probably null
R1655:Tg UTSW 15 66,700,417 (GRCm39) critical splice donor site probably null
R1671:Tg UTSW 15 66,564,236 (GRCm39) missense possibly damaging 0.89
R1789:Tg UTSW 15 66,609,397 (GRCm39) missense probably benign 0.00
R1883:Tg UTSW 15 66,543,158 (GRCm39) missense probably damaging 1.00
R1984:Tg UTSW 15 66,554,691 (GRCm39) missense probably benign
R2063:Tg UTSW 15 66,700,402 (GRCm39) missense probably damaging 1.00
R2092:Tg UTSW 15 66,721,456 (GRCm39) missense probably null 0.26
R2109:Tg UTSW 15 66,601,443 (GRCm39) missense probably benign 0.02
R2128:Tg UTSW 15 66,566,743 (GRCm39) missense probably benign 0.10
R2129:Tg UTSW 15 66,566,743 (GRCm39) missense probably benign 0.10
R2207:Tg UTSW 15 66,553,788 (GRCm39) missense probably benign 0.15
R2219:Tg UTSW 15 66,553,782 (GRCm39) missense probably benign 0.03
R2228:Tg UTSW 15 66,545,860 (GRCm39) missense probably damaging 0.99
R2229:Tg UTSW 15 66,545,860 (GRCm39) missense probably damaging 0.99
R2259:Tg UTSW 15 66,555,747 (GRCm39) missense probably benign
R2994:Tg UTSW 15 66,553,802 (GRCm39) missense probably benign
R3904:Tg UTSW 15 66,638,011 (GRCm39) nonsense probably null
R3946:Tg UTSW 15 66,545,872 (GRCm39) missense probably damaging 1.00
R3965:Tg UTSW 15 66,556,039 (GRCm39) missense probably benign
R4245:Tg UTSW 15 66,568,318 (GRCm39) missense possibly damaging 0.68
R4451:Tg UTSW 15 66,637,996 (GRCm39) missense probably benign 0.01
R4487:Tg UTSW 15 66,543,245 (GRCm39) missense probably damaging 1.00
R4489:Tg UTSW 15 66,579,791 (GRCm39) missense probably damaging 1.00
R4623:Tg UTSW 15 66,607,120 (GRCm39) missense probably benign 0.23
R4659:Tg UTSW 15 66,545,769 (GRCm39) missense possibly damaging 0.67
R4728:Tg UTSW 15 66,554,676 (GRCm39) missense probably damaging 1.00
R4760:Tg UTSW 15 66,565,168 (GRCm39) missense probably damaging 1.00
R4797:Tg UTSW 15 66,629,855 (GRCm39) critical splice donor site probably null
R4944:Tg UTSW 15 66,636,186 (GRCm39) missense probably damaging 1.00
R4998:Tg UTSW 15 66,545,899 (GRCm39) missense probably damaging 1.00
R5009:Tg UTSW 15 66,568,435 (GRCm39) missense probably benign 0.01
R5025:Tg UTSW 15 66,579,779 (GRCm39) missense probably damaging 1.00
R5035:Tg UTSW 15 66,553,662 (GRCm39) splice site probably null
R5049:Tg UTSW 15 66,699,231 (GRCm39) nonsense probably null
R5073:Tg UTSW 15 66,607,101 (GRCm39) missense probably benign 0.05
R5169:Tg UTSW 15 66,550,629 (GRCm39) nonsense probably null
R5185:Tg UTSW 15 66,645,323 (GRCm39) missense probably damaging 1.00
R5227:Tg UTSW 15 66,631,416 (GRCm39) missense possibly damaging 0.87
R5300:Tg UTSW 15 66,550,704 (GRCm39) missense probably damaging 1.00
R5334:Tg UTSW 15 66,549,904 (GRCm39) missense probably damaging 1.00
R5339:Tg UTSW 15 66,549,942 (GRCm39) missense probably damaging 1.00
R5402:Tg UTSW 15 66,611,017 (GRCm39) missense probably damaging 0.98
R5441:Tg UTSW 15 66,568,369 (GRCm39) missense possibly damaging 0.47
R5509:Tg UTSW 15 66,699,142 (GRCm39) missense probably benign 0.45
R5580:Tg UTSW 15 66,557,149 (GRCm39) missense possibly damaging 0.66
R5582:Tg UTSW 15 66,565,284 (GRCm39) missense probably damaging 1.00
R5624:Tg UTSW 15 66,709,906 (GRCm39) missense probably benign 0.11
R5686:Tg UTSW 15 66,560,738 (GRCm39) missense probably benign 0.28
R6042:Tg UTSW 15 66,555,842 (GRCm39) missense probably benign 0.01
R6122:Tg UTSW 15 66,700,306 (GRCm39) missense probably damaging 1.00
R6146:Tg UTSW 15 66,545,216 (GRCm39) splice site probably null
R6159:Tg UTSW 15 66,607,096 (GRCm39) missense possibly damaging 0.71
R6223:Tg UTSW 15 66,579,771 (GRCm39) missense probably benign 0.15
R6480:Tg UTSW 15 66,543,160 (GRCm39) missense probably damaging 1.00
R6505:Tg UTSW 15 66,631,407 (GRCm39) missense probably damaging 0.99
R6531:Tg UTSW 15 66,711,211 (GRCm39) missense probably damaging 0.99
R6614:Tg UTSW 15 66,607,108 (GRCm39) missense probably damaging 0.99
R6698:Tg UTSW 15 66,711,211 (GRCm39) missense probably damaging 1.00
R6798:Tg UTSW 15 66,550,688 (GRCm39) missense probably damaging 1.00
R6837:Tg UTSW 15 66,567,984 (GRCm39) missense probably damaging 1.00
R6861:Tg UTSW 15 66,560,740 (GRCm39) missense probably benign 0.00
R6888:Tg UTSW 15 66,568,095 (GRCm39) missense probably damaging 0.99
R6933:Tg UTSW 15 66,636,158 (GRCm39) missense possibly damaging 0.73
R6983:Tg UTSW 15 66,565,207 (GRCm39) missense probably benign 0.01
R7078:Tg UTSW 15 66,545,392 (GRCm39) missense probably damaging 1.00
R7244:Tg UTSW 15 66,612,563 (GRCm39) missense probably damaging 1.00
R7320:Tg UTSW 15 66,566,633 (GRCm39) missense possibly damaging 0.71
R7334:Tg UTSW 15 66,597,121 (GRCm39) missense probably benign 0.01
R7418:Tg UTSW 15 66,568,432 (GRCm39) missense probably damaging 0.99
R7485:Tg UTSW 15 66,568,437 (GRCm39) missense probably benign 0.04
R7524:Tg UTSW 15 66,568,010 (GRCm39) missense probably benign 0.01
R7529:Tg UTSW 15 66,566,617 (GRCm39) missense probably damaging 0.99
R7540:Tg UTSW 15 66,561,776 (GRCm39) missense probably benign 0.16
R7583:Tg UTSW 15 66,636,267 (GRCm39) missense probably damaging 1.00
R7594:Tg UTSW 15 66,601,432 (GRCm39) missense probably benign 0.20
R7667:Tg UTSW 15 66,587,012 (GRCm39) missense probably damaging 0.98
R7722:Tg UTSW 15 66,636,158 (GRCm39) missense possibly damaging 0.73
R7838:Tg UTSW 15 66,565,112 (GRCm39) missense probably benign 0.00
R7890:Tg UTSW 15 66,555,663 (GRCm39) missense probably damaging 1.00
R7904:Tg UTSW 15 66,577,128 (GRCm39) missense probably benign 0.08
R7919:Tg UTSW 15 66,555,923 (GRCm39) missense possibly damaging 0.73
R7921:Tg UTSW 15 66,555,642 (GRCm39) missense probably benign 0.08
R8037:Tg UTSW 15 66,560,724 (GRCm39) missense probably benign 0.00
R8038:Tg UTSW 15 66,560,724 (GRCm39) missense probably benign 0.00
R8214:Tg UTSW 15 66,645,247 (GRCm39) missense probably damaging 1.00
R8304:Tg UTSW 15 66,565,109 (GRCm39) nonsense probably null
R8688:Tg UTSW 15 66,566,802 (GRCm39) critical splice donor site probably benign
R8709:Tg UTSW 15 66,553,786 (GRCm39) missense probably benign 0.08
R8714:Tg UTSW 15 66,555,891 (GRCm39) missense probably damaging 0.97
R8901:Tg UTSW 15 66,557,184 (GRCm39) missense probably damaging 1.00
R8917:Tg UTSW 15 66,645,332 (GRCm39) critical splice donor site probably null
R9023:Tg UTSW 15 66,555,522 (GRCm39) missense probably damaging 1.00
R9232:Tg UTSW 15 66,570,310 (GRCm39) missense probably benign 0.01
R9310:Tg UTSW 15 66,699,118 (GRCm39) missense possibly damaging 0.69
R9361:Tg UTSW 15 66,557,246 (GRCm39) missense possibly damaging 0.50
R9389:Tg UTSW 15 66,561,173 (GRCm39) missense probably benign 0.04
R9501:Tg UTSW 15 66,718,923 (GRCm39) missense possibly damaging 0.52
R9510:Tg UTSW 15 66,545,913 (GRCm39) missense probably damaging 1.00
R9594:Tg UTSW 15 66,607,109 (GRCm39) nonsense probably null
R9629:Tg UTSW 15 66,555,587 (GRCm39) missense possibly damaging 0.95
R9701:Tg UTSW 15 66,637,991 (GRCm39) missense probably benign 0.03
R9743:Tg UTSW 15 66,561,839 (GRCm39) missense probably benign 0.18
R9748:Tg UTSW 15 66,719,008 (GRCm39) missense possibly damaging 0.91
T0975:Tg UTSW 15 66,560,712 (GRCm39) missense probably benign 0.01
X0005:Tg UTSW 15 66,560,712 (GRCm39) missense probably benign 0.01
X0065:Tg UTSW 15 66,554,303 (GRCm39) missense probably damaging 1.00
X0067:Tg UTSW 15 66,620,592 (GRCm39) missense probably benign 0.10
Z1177:Tg UTSW 15 66,721,396 (GRCm39) missense probably benign 0.02
Z1177:Tg UTSW 15 66,557,159 (GRCm39) missense possibly damaging 0.49
Predicted Primers PCR Primer
(F):5'- TTTGCCCTTGAAGACCATATGAC -3'
(R):5'- TGAGCATCTCATGAAAAGGGGC -3'

Sequencing Primer
(F):5'- CCTTGAAGACCATATGACATGATAAC -3'
(R):5'- CATCTCATGAAAAGGGGCTATGC -3'
Posted On 2019-11-26