Mutagenetix > Incidental Mutations

Incidental Mutation 'R7790:Taf4b'

599849

Institutional Source

Beutler Lab

Gene Symbol

Taf4b

Ensembl Gene

ENSMUSG00000054321

Gene Name

TATA-box binding protein associated factor 4b

Synonyms

Taf2c2, TAFII105, 2610524B04Rik, 105kDa, 4932409F03Rik

MMRRC Submission

Accession Numbers

Is this an essential gene?

Possibly non essential (E-score: 0.481) question?

Stock #

R7790 (G1)

Quality Score

225.009

Status

Validated

Chromosome

Chromosomal Location

14783245-14900359 bp(+) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

T to C at 14813274 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Serine to Proline at position 385 (S385P)

Ref Sequence

ENSEMBL: ENSMUSP00000126909 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000169862]

AlphaFold

no structure available at present

Predicted Effect

probably damaging
Transcript: ENSMUST00000169862
AA Change: S385P

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)

SMART Domains

Protein: ENSMUSP00000126909
Gene: ENSMUSG00000054321
AA Change: S385P

Domain	Start	End	E-Value	Type
low complexity region	8	23	N/A	INTRINSIC
low complexity region	185	196	N/A	INTRINSIC
Pfam:TAFH	257	348	5.3e-39	PFAM
low complexity region	359	376	N/A	INTRINSIC
low complexity region	412	422	N/A	INTRINSIC
Pfam:TAF4	610	852	4e-72	PFAM

Meta Mutation Damage Score

0.1059

Coding Region Coverage

1x: 100.0%
3x: 99.9%
10x: 99.7%
20x: 99.0%

Validation Efficiency

100% (81/81)

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] TATA binding protein (TBP) and TBP-associated factors (TAFs) participate in the formation of the TFIID protein complex, which is involved in initiation of transcription of genes by RNA polymerase II. This gene encodes a cell type-specific TAF that may be responsible for mediating transcription by a subset of activators in B cells. Three transcript variants encoding two different isoforms have been found for this gene. [provided by RefSeq, Jun 2014]
PHENOTYPE: Homozygotes for a targeted null mutation are infertile due to a granulosa cell defect preventing normal follicle formation. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 83 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
1700009N14Rik	A	T	4: 39,451,201	I136F	possibly damaging	Het
3110043O21Rik	T	C	4: 35,192,997	D444G	unknown	Het
4932415D10Rik	C	T	10: 82,287,495	C3227Y	probably benign	Het
Abca13	A	T	11: 9,297,915	K2554M	probably damaging	Het
Ankrd12	C	T	17: 65,984,230	D1403N	possibly damaging	Het
Ankrd17	A	G	5: 90,260,152	V1402A	possibly damaging	Het
Ankrd36	A	T	11: 5,635,176	N329I	possibly damaging	Het
Atr	A	T	9: 95,874,180	D815V	probably damaging	Het
Ceacam1	T	C	7: 25,473,950	Y271C	probably damaging	Het
Cenpo	T	C	12: 4,214,597	H265R	probably benign	Het
Chd8	G	A	14: 52,226,082	R702W	probably damaging	Het
Ckap5	A	G	2: 91,559,110	N309S	probably benign	Het
Cxxc1	C	T	18: 74,217,784	R83C	probably damaging	Het
Dcaf6	T	C	1: 165,399,715	D281G	probably damaging	Het
Dennd4c	A	G	4: 86,799,517	T584A	probably damaging	Het
Dync2h1	G	T	9: 7,114,914	H2415N	probably damaging	Het
Dzip1l	A	G	9: 99,660,962	E490G	possibly damaging	Het
Fam124a	T	C	14: 62,606,077	S345P	probably benign	Het
Fam83b	G	A	9: 76,492,048	T591I	probably benign	Het
Frem1	T	C	4: 82,989,164	S838G	probably benign	Het
Fsip2	G	T	2: 82,988,379	D4819Y	probably benign	Het
Gm43302	T	G	5: 105,277,825	K246T	probably benign	Het
Gm5861	C	A	5: 11,184,218	H30Q	probably benign	Het
Gml	T	C	15: 74,813,613		probably benign	Het
Gpc1	A	T	1: 92,853,449	H90L	probably benign	Het
Grik3	T	C	4: 125,686,019	L519P	probably damaging	Het
Grwd1	A	G	7: 45,826,014	V368A	probably damaging	Het
Gstm3	G	A	3: 107,969,239		probably benign	Het
Gtpbp6	A	G	5: 110,104,386	S427P	probably damaging	Het
Heatr5b	C	T	17: 78,818,823	G560E	probably damaging	Het
Heatr9	A	G	11: 83,518,193	V176A	probably damaging	Het
Hsf2bp	A	G	17: 32,034,479	V5A	probably benign	Het
Ints3	G	T	3: 90,400,413	Q660K	probably benign	Het
Itpr2	A	T	6: 146,224,776	L2048Q	probably damaging	Het
Kcnq1	G	A	7: 143,106,605		probably null	Het
Lsm12	A	T	11: 102,165,169		probably null	Het
Mcoln3	A	G	3: 146,139,492	Y481C	probably damaging	Het
Meis3	A	G	7: 16,182,397	N266D	probably benign	Het
Mgat5	G	A	1: 127,412,204	E441K	probably benign	Het
Mroh6	C	T	15: 75,884,240	R689H	probably benign	Het
Mtg1	T	C	7: 140,149,749	Y251H	probably damaging	Het
Mtus2	A	T	5: 148,078,188	Q597L	probably benign	Het
Myt1	A	G	2: 181,797,597	E346G	probably benign	Het
Nat8f4	A	G	6: 85,900,891	S217P	probably benign	Het
Ngf	G	A	3: 102,509,824	G17R	unknown	Het
Olfr863-ps1	A	T	9: 19,941,684	M252K	unknown	Het
Pam	T	C	1: 97,821,847	Y968C	probably damaging	Het
Pcdhga7	T	A	18: 37,714,943	M1K	probably null	Het
Pde8b	G	T	13: 95,034,171	D554E	probably benign	Het
Pdzd7	G	A	19: 45,045,523	R41*	probably null	Het
Pkhd1l1	C	T	15: 44,578,581	P3639S	probably damaging	Het
Plce1	A	T	19: 38,780,696	E2280V	probably damaging	Het
Prrxl1	T	A	14: 32,628,888	L227Q	probably damaging	Het
Ryr1	T	C	7: 29,104,832	I538V	probably benign	Het
Scaf11	A	G	15: 96,419,061	L874P	possibly damaging	Het
Scpep1	G	T	11: 88,933,521	D307E	possibly damaging	Het
Sept4	A	G	11: 87,589,239	E327G	probably damaging	Het
Skint2	T	G	4: 112,616,554	V11G	possibly damaging	Het
Slc26a4	T	C	12: 31,544,483	N289D	probably damaging	Het
Slc35f3	CTCTCTCTCTCTCTCTCTCTCTCTCTCTCTCTCTCTCTCTCTC	CTCTCTCTCTCTCTCTCTCTCTCTCTCTCTCTCTCTCTCTCTCTC	8: 126,389,038		unknown	Het
Slx4	T	C	16: 3,986,982	E656G	probably benign	Het
Socs5	T	C	17: 87,134,363	S244P	probably benign	Het
Stt3b	A	C	9: 115,276,819	L196R	probably damaging	Het
Syne2	T	A	12: 75,929,103		probably null	Het
Tab2	T	A	10: 7,920,424	N24I	probably damaging	Het
Tg	T	C	15: 66,849,604	Y2720H	probably damaging	Het
Tjap1	C	T	17: 46,258,690	G448E	probably benign	Het
Tll1	A	T	8: 64,025,237	C827*	probably null	Het
Tlr11	T	A	14: 50,361,925	I456K	probably benign	Het
Tmem209	T	C	6: 30,497,855	D305G	probably damaging	Het
Tmem82	A	T	4: 141,617,724		probably null	Het
Tnfrsf14	A	G	4: 154,923,293	V207A	probably benign	Het
Tnks	A	T	8: 34,861,540	N625K	probably benign	Het
Tomm20	G	A	8: 126,939,950	P58S	possibly damaging	Het
Ttc9b	A	G	7: 27,654,336	D137G	probably benign	Het
Ulk4	C	T	9: 121,263,668	E168K	possibly damaging	Het
Usp9y	T	A	Y: 1,444,573	D122V	probably damaging	Het
Vps41	C	A	13: 18,842,268	T512K	possibly damaging	Het
Wdr49	T	A	3: 75,275,028	N698I	probably benign	Het
Zfp568	G	A	7: 30,022,725	C365Y	probably damaging	Het
Zfp663	A	T	2: 165,352,533	C589S	probably damaging	Het
Zfp971	A	G	2: 178,033,499	K297R	probably damaging	Het
Zkscan16	G	T	4: 58,951,843	E173*	probably null	Het

Other mutations in Taf4b

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL01658:Taf4b	APN	18	14844420	missense	probably damaging	1.00
IGL01755:Taf4b	APN	18	14897985	missense	probably benign
IGL01755:Taf4b	APN	18	14897986	missense	probably benign	0.13
IGL02049:Taf4b	APN	18	14830139	missense	probably benign	0.00
IGL02650:Taf4b	APN	18	14841983	nonsense	probably null
IGL03078:Taf4b	APN	18	14813554	missense	possibly damaging	0.48
IGL03169:Taf4b	APN	18	14821535	missense	probably damaging	1.00
IGL03261:Taf4b	APN	18	14821528	missense	probably benign
adirondack	UTSW	18	14804578	missense	probably null	0.16
R0266:Taf4b	UTSW	18	14813077	splice site	probably benign
R0385:Taf4b	UTSW	18	14783760	missense	probably benign	0.00
R1015:Taf4b	UTSW	18	14813098	missense	probably damaging	1.00
R1054:Taf4b	UTSW	18	14821473	missense	probably benign	0.00
R1416:Taf4b	UTSW	18	14821427	splice site	probably benign
R1435:Taf4b	UTSW	18	14807409	missense	probably damaging	1.00
R1609:Taf4b	UTSW	18	14835881	missense	probably damaging	1.00
R1611:Taf4b	UTSW	18	14844469	missense	probably null	1.00
R1906:Taf4b	UTSW	18	14822102	missense	probably benign	0.00
R2038:Taf4b	UTSW	18	14807399	missense	probably damaging	1.00
R2890:Taf4b	UTSW	18	14804792	missense	probably damaging	1.00
R4527:Taf4b	UTSW	18	14821442	missense	probably damaging	1.00
R4559:Taf4b	UTSW	18	14813526	missense	probably damaging	1.00
R4773:Taf4b	UTSW	18	14804520	missense	probably benign	0.30
R4857:Taf4b	UTSW	18	14804578	missense	probably null	0.16
R4946:Taf4b	UTSW	18	14813542	missense	probably damaging	1.00
R4984:Taf4b	UTSW	18	14835816	missense	probably damaging	1.00
R4994:Taf4b	UTSW	18	14898043	missense	probably damaging	0.99
R5010:Taf4b	UTSW	18	14822172	missense	possibly damaging	0.59
R5155:Taf4b	UTSW	18	14830095	missense	probably benign	0.07
R5874:Taf4b	UTSW	18	14804554	missense	probably benign
R6079:Taf4b	UTSW	18	14822198	missense	possibly damaging	0.75
R6303:Taf4b	UTSW	18	14807355	missense	probably damaging	1.00
R6304:Taf4b	UTSW	18	14807355	missense	probably damaging	1.00
R6372:Taf4b	UTSW	18	14804733	missense	probably damaging	1.00
R6972:Taf4b	UTSW	18	14813347	missense	possibly damaging	0.86
R7538:Taf4b	UTSW	18	14813545	missense	probably damaging	1.00
R8021:Taf4b	UTSW	18	14804524	missense	probably damaging	1.00
R8072:Taf4b	UTSW	18	14821528	missense	probably benign
R8075:Taf4b	UTSW	18	14783692	missense	possibly damaging	0.58
R8145:Taf4b	UTSW	18	14830028	missense	probably damaging	1.00
R8221:Taf4b	UTSW	18	14898049	missense	probably damaging	1.00
R8320:Taf4b	UTSW	18	14783692	missense	possibly damaging	0.58
R8509:Taf4b	UTSW	18	14898055	missense	probably damaging	1.00
R8535:Taf4b	UTSW	18	14822138	missense	probably damaging	0.99
R8772:Taf4b	UTSW	18	14835852	missense	probably damaging	1.00
R8805:Taf4b	UTSW	18	14813428	missense	possibly damaging	0.65
R8874:Taf4b	UTSW	18	14830070	missense	probably benign	0.39
R9155:Taf4b	UTSW	18	14813239	missense	probably benign	0.00
R9254:Taf4b	UTSW	18	14813374	missense	probably damaging	0.98
R9338:Taf4b	UTSW	18	14821498	missense	probably benign	0.00
R9379:Taf4b	UTSW	18	14813374	missense	probably damaging	0.98

Predicted Primers

PCR Primer
(F):5'- TGGTTGCCCTAAGACAGCTTC -3'
(R):5'- TAGCCAGTGTTACTGCTGC -3'

Sequencing Primer
(F):5'- AGCTTCTTCCAAATTCCCAGAG -3'
(R):5'- ACAACTGGATTCTCAGGCTG -3'

Posted On

2019-11-26