Mutagenetix > Incidental Mutation

Incidental Mutation 'R7791:Vil1'

599856

Institutional Source

Beutler Lab

Gene Symbol

Vil1

Ensembl Gene

ENSMUSG00000026175

Gene Name

villin 1

Synonyms

MMRRC Submission

Accession Numbers

Essential gene?

Possibly non essential (E-score: 0.299) question?

Stock #

R7791 (G1)

Quality Score

225.009

Status

Validated

Chromosome

Chromosomal Location

74409376-74435559 bp(+) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

T to C at 74428136 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Tyrosine to Histidine at position 681 (Y681H)

Ref Sequence

ENSEMBL: ENSMUSP00000027366 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000027366]

AlphaFold

Q62468

Predicted Effect

probably damaging
Transcript: ENSMUST00000027366
AA Change: Y681H

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)

SMART Domains

Protein: ENSMUSP00000027366
Gene: ENSMUSG00000026175
AA Change: Y681H

Domain	Start	End	E-Value	Type
GEL	17	114	2.93e-29	SMART
GEL	135	229	1.33e-18	SMART
GEL	251	349	5.85e-29	SMART
GEL	398	495	1.44e-28	SMART
GEL	515	601	7.31e-30	SMART
GEL	620	714	1.36e-29	SMART
VHP	792	827	1.77e-14	SMART

Meta Mutation Damage Score

0.9418

Coding Region Coverage

1x: 100.0%
3x: 99.9%
10x: 99.6%
20x: 98.8%

Validation Efficiency

100% (51/51)

MGI Phenotype

Strain: 1859841
FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of a family of calcium-regulated actin-binding proteins. This protein represents a dominant part of the brush border cytoskeleton which functions in the capping, severing, and bundling of actin filaments. Two mRNAs of 2.7 kb and 3.5 kb have been observed; they result from utilization of alternate poly-adenylation signals present in the terminal exon. [provided by RefSeq, Jul 2008]
PHENOTYPE: Homozygous null mutants do not exhibit gross abnormalities or apparent defects of microvilli morphogenesis, however in one line, an increased sensitivity to colitis induced by dextran sulfate was observed. [provided by MGI curators]

Allele List at MGI

All alleles(8) : Targeted(4) Gene trapped(4)

Other mutations in this stock

Total: 51 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
4921517D22Rik	A	T	13: 59,690,694	M108K	probably benign	Het
Adamts9	A	T	6: 92,872,385	V1031D	probably benign	Het
Agap3	C	T	5: 24,476,413	R122C	probably damaging	Het
Arhgap27	A	G	11: 103,339,194		probably null	Het
Atp1a2	T	A	1: 172,276,215	I950F	probably benign	Het
Bahcc1	T	G	11: 120,268,377	H143Q	probably damaging	Het
Bcl7b	T	A	5: 135,171,114	D40E	probably damaging	Het
C9	C	T	15: 6,489,878	R399C	possibly damaging	Het
Capn13	T	C	17: 73,382,888	I43V	possibly damaging	Het
Ctcf	A	G	8: 105,664,939	T289A	possibly damaging	Het
Cux2	T	C	5: 121,867,099	N1008S	probably benign	Het
Dst	T	A	1: 34,154,592	M294K	probably damaging	Het
Eml4	G	T	17: 83,473,706	D778Y	probably benign	Het
Exoc3l4	A	C	12: 111,423,540	D183A	probably damaging	Het
Eya4	A	T	10: 23,113,926	S511T	probably damaging	Het
Fbrsl1	T	C	5: 110,448,019	H50R	probably benign	Het
Gemin5	G	A	11: 58,124,993	P1396S	probably benign	Het
Gm13178	A	G	4: 144,703,445	S325P	probably damaging	Het
Gnb4	A	G	3: 32,590,043	F151L	possibly damaging	Het
Gnptab	A	G	10: 88,440,222		probably null	Het
Gpbp1l1	T	A	4: 116,574,420	W92R	probably damaging	Het
Gucy1b1	A	T	3: 82,035,397	Y479*	probably null	Het
Htr3a	T	A	9: 48,901,575	Q188L	possibly damaging	Het
Ighv5-9-1	A	G	12: 113,736,545	F18S	probably damaging	Het
Loxhd1	A	G	18: 77,383,729	T1004A	probably damaging	Het
Mansc4	G	A	6: 147,081,544	L132F	unknown	Het
Mmp1a	TG	TGG	9: 7,465,083		probably null	Het
Mtor	G	T	4: 148,462,940	R460L	probably benign	Het
Mtus1	A	T	8: 41,083,380	F433Y	possibly damaging	Het
Myoc	T	C	1: 162,649,121	Y465H	probably damaging	Het
N4bp1	A	G	8: 86,853,203	V657A	probably damaging	Het
Ndufv1	A	T	19: 4,011,533		probably null	Het
Nectin1	T	C	9: 43,792,039	I198T	probably benign	Het
Olfr239	T	A	17: 33,199,352	C101*	probably null	Het
Olfr44	T	C	9: 39,484,881	D124G	probably damaging	Het
Padi2	C	T	4: 140,917,596	T47I	probably benign	Het
Pdia4	A	T	6: 47,807,122	I116N	probably damaging	Het
Pkdrej	T	A	15: 85,815,931	I1935L	possibly damaging	Het
Pnpla7	C	A	2: 25,052,066	A1173D	probably damaging	Het
Ralgapa1	A	T	12: 55,741,519	L593Q	probably damaging	Het
Scn5a	A	G	9: 119,543,336	S231P	possibly damaging	Het
Slc13a2	A	G	11: 78,422,064		probably null	Het
Spdl1	A	G	11: 34,813,477	S510P	possibly damaging	Het
Tbxa2r	G	T	10: 81,334,706	*342L	probably null	Het
Tfrc	A	G	16: 32,619,167	K346R	probably benign	Het
Tmem52b	A	G	6: 129,513,003		probably benign	Het
Tsc1	T	C	2: 28,681,948	F844L	probably damaging	Het
Ttc39a	A	G	4: 109,426,347	N158S	probably benign	Het
Ulk4	C	T	9: 121,263,668	E168K	possibly damaging	Het
Vgf	T	C	5: 137,032,031	L349P	unknown	Het
Zfp654	A	G	16: 64,783,271	*572R	probably null	Het

Other mutations in Vil1

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00162:Vil1	APN	1	74423875	missense	probably damaging	1.00
IGL00703:Vil1	APN	1	74423960	missense	possibly damaging	0.61
IGL01011:Vil1	APN	1	74434887	splice site	probably null
IGL01314:Vil1	APN	1	74428238	missense	probably damaging	1.00
IGL01772:Vil1	APN	1	74415119	missense	probably benign
IGL02378:Vil1	APN	1	74430691	splice site	probably null
IGL02517:Vil1	APN	1	74426692	missense	probably benign	0.43
IGL02955:Vil1	APN	1	74418523	missense	probably benign	0.10
IGL03036:Vil1	APN	1	74419612	missense	probably damaging	1.00
PIT4362001:Vil1	UTSW	1	74421383	missense	probably damaging	1.00
R0104:Vil1	UTSW	1	74418366	missense	probably benign	0.44
R0241:Vil1	UTSW	1	74426694	missense	probably damaging	1.00
R0241:Vil1	UTSW	1	74426694	missense	probably damaging	1.00
R0496:Vil1	UTSW	1	74421340	missense	possibly damaging	0.88
R1329:Vil1	UTSW	1	74427558	missense	probably benign	0.00
R1824:Vil1	UTSW	1	74418447	missense	probably benign	0.00
R1916:Vil1	UTSW	1	74418525	missense	probably benign
R2188:Vil1	UTSW	1	74427565	missense	probably benign	0.22
R2216:Vil1	UTSW	1	74425679	missense	probably benign	0.05
R3808:Vil1	UTSW	1	74427613	missense	probably benign
R3939:Vil1	UTSW	1	74432415	missense	probably benign	0.09
R4288:Vil1	UTSW	1	74418525	missense	probably benign
R4648:Vil1	UTSW	1	74432298	missense	probably benign
R4748:Vil1	UTSW	1	74421266	missense	probably damaging	1.00
R5333:Vil1	UTSW	1	74432390	missense	probably benign
R5429:Vil1	UTSW	1	74432331	missense	probably benign	0.05
R5973:Vil1	UTSW	1	74416033	missense	possibly damaging	0.93
R6007:Vil1	UTSW	1	74419867	missense	probably damaging	1.00
R6247:Vil1	UTSW	1	74432339	missense	probably benign
R6306:Vil1	UTSW	1	74421311	missense	possibly damaging	0.90
R6989:Vil1	UTSW	1	74423954	missense	probably damaging	0.99
R7112:Vil1	UTSW	1	74416002	missense	probably damaging	1.00
R7320:Vil1	UTSW	1	74418444	missense	probably damaging	1.00
R7481:Vil1	UTSW	1	74419899	missense	probably damaging	1.00
R7553:Vil1	UTSW	1	74426732	critical splice donor site	probably null
R7709:Vil1	UTSW	1	74426595	missense	probably benign	0.39
R8159:Vil1	UTSW	1	74423977	missense	probably benign	0.00
R8190:Vil1	UTSW	1	74434893	nonsense	probably null
R9650:Vil1	UTSW	1	74425616	missense	probably benign	0.32
R9679:Vil1	UTSW	1	74430674	missense	probably benign	0.00
R9734:Vil1	UTSW	1	74415150	missense	possibly damaging	0.46
Z1176:Vil1	UTSW	1	74428232	missense	probably damaging	0.98
Z1177:Vil1	UTSW	1	74415132	missense	probably damaging	1.00
Z1177:Vil1	UTSW	1	74421430	missense	probably benign

Predicted Primers

PCR Primer
(F):5'- AGGTCTTTCTAGCTGGGCATC -3'
(R):5'- AAGGCTAGTGGCATCTGGAC -3'

Sequencing Primer
(F):5'- CTAGCTGGGCATCGGGGATG -3'
(R):5'- GGATTGTGCCATGAAGCTACC -3'

Posted On

2019-11-26