Incidental Mutation 'R7791:Vil1'
ID599856
Institutional Source Beutler Lab
Gene Symbol Vil1
Ensembl Gene ENSMUSG00000026175
Gene Namevillin 1
Synonyms
MMRRC Submission
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.247) question?
Stock #R7791 (G1)
Quality Score225.009
Status Validated
Chromosome1
Chromosomal Location74409376-74435559 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 74428136 bp
ZygosityHeterozygous
Amino Acid Change Tyrosine to Histidine at position 681 (Y681H)
Ref Sequence ENSEMBL: ENSMUSP00000027366 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000027366]
Predicted Effect probably damaging
Transcript: ENSMUST00000027366
AA Change: Y681H

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000027366
Gene: ENSMUSG00000026175
AA Change: Y681H

DomainStartEndE-ValueType
GEL 17 114 2.93e-29 SMART
GEL 135 229 1.33e-18 SMART
GEL 251 349 5.85e-29 SMART
GEL 398 495 1.44e-28 SMART
GEL 515 601 7.31e-30 SMART
GEL 620 714 1.36e-29 SMART
VHP 792 827 1.77e-14 SMART
Meta Mutation Damage Score 0.9418 question?
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.6%
  • 20x: 98.8%
Validation Efficiency 100% (51/51)
MGI Phenotype Strain: 1859841
FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of a family of calcium-regulated actin-binding proteins. This protein represents a dominant part of the brush border cytoskeleton which functions in the capping, severing, and bundling of actin filaments. Two mRNAs of 2.7 kb and 3.5 kb have been observed; they result from utilization of alternate poly-adenylation signals present in the terminal exon. [provided by RefSeq, Jul 2008]
PHENOTYPE: Homozygous null mutants do not exhibit gross abnormalities or apparent defects of microvilli morphogenesis, however in one line, an increased sensitivity to colitis induced by dextran sulfate was observed. [provided by MGI curators]
Allele List at MGI

All alleles(8) : Targeted(4) Gene trapped(4)          

Other mutations in this stock
Total: 51 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4921517D22Rik A T 13: 59,690,694 M108K probably benign Het
Adamts9 A T 6: 92,872,385 V1031D probably benign Het
Agap3 C T 5: 24,476,413 R122C probably damaging Het
Arhgap27 A G 11: 103,339,194 probably null Het
Atp1a2 T A 1: 172,276,215 I950F probably benign Het
Bahcc1 T G 11: 120,268,377 H143Q probably damaging Het
Bcl7b T A 5: 135,171,114 D40E probably damaging Het
C9 C T 15: 6,489,878 R399C possibly damaging Het
Capn13 T C 17: 73,382,888 I43V possibly damaging Het
Ctcf A G 8: 105,664,939 T289A possibly damaging Het
Cux2 T C 5: 121,867,099 N1008S probably benign Het
Dst T A 1: 34,154,592 M294K probably damaging Het
Eml4 G T 17: 83,473,706 D778Y probably benign Het
Exoc3l4 A C 12: 111,423,540 D183A probably damaging Het
Eya4 A T 10: 23,113,926 S511T probably damaging Het
Fbrsl1 T C 5: 110,448,019 H50R probably benign Het
Gemin5 G A 11: 58,124,993 P1396S probably benign Het
Gm13178 A G 4: 144,703,445 S325P probably damaging Het
Gnb4 A G 3: 32,590,043 F151L possibly damaging Het
Gnptab A G 10: 88,440,222 probably null Het
Gpbp1l1 T A 4: 116,574,420 W92R probably damaging Het
Gucy1b1 A T 3: 82,035,397 Y479* probably null Het
Htr3a T A 9: 48,901,575 Q188L possibly damaging Het
Ighv5-9-1 A G 12: 113,736,545 F18S probably damaging Het
Loxhd1 A G 18: 77,383,729 T1004A probably damaging Het
Mansc4 G A 6: 147,081,544 L132F unknown Het
Mmp1a TG TGG 9: 7,465,083 probably null Het
Mtor G T 4: 148,462,940 R460L probably benign Het
Mtus1 A T 8: 41,083,380 F433Y possibly damaging Het
Myoc T C 1: 162,649,121 Y465H probably damaging Het
N4bp1 A G 8: 86,853,203 V657A probably damaging Het
Ndufv1 A T 19: 4,011,533 probably null Het
Nectin1 T C 9: 43,792,039 I198T probably benign Het
Olfr239 T A 17: 33,199,352 C101* probably null Het
Olfr44 T C 9: 39,484,881 D124G probably damaging Het
Padi2 C T 4: 140,917,596 T47I probably benign Het
Pdia4 A T 6: 47,807,122 I116N probably damaging Het
Pkdrej T A 15: 85,815,931 I1935L possibly damaging Het
Pnpla7 C A 2: 25,052,066 A1173D probably damaging Het
Ralgapa1 A T 12: 55,741,519 L593Q probably damaging Het
Scn5a A G 9: 119,543,336 S231P possibly damaging Het
Slc13a2 A G 11: 78,422,064 probably null Het
Spdl1 A G 11: 34,813,477 S510P possibly damaging Het
Tbxa2r G T 10: 81,334,706 *342L probably null Het
Tfrc A G 16: 32,619,167 K346R probably benign Het
Tmem52b A G 6: 129,513,003 probably benign Het
Tsc1 T C 2: 28,681,948 F844L probably damaging Het
Ttc39a A G 4: 109,426,347 N158S probably benign Het
Ulk4 C T 9: 121,263,668 E168K possibly damaging Het
Vgf T C 5: 137,032,031 L349P unknown Het
Zfp654 A G 16: 64,783,271 *572R probably null Het
Other mutations in Vil1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00162:Vil1 APN 1 74423875 missense probably damaging 1.00
IGL00703:Vil1 APN 1 74423960 missense possibly damaging 0.61
IGL01011:Vil1 APN 1 74434887 splice site probably null
IGL01314:Vil1 APN 1 74428238 missense probably damaging 1.00
IGL01772:Vil1 APN 1 74415119 missense probably benign
IGL02378:Vil1 APN 1 74430691 splice site probably null
IGL02517:Vil1 APN 1 74426692 missense probably benign 0.43
IGL02955:Vil1 APN 1 74418523 missense probably benign 0.10
IGL03036:Vil1 APN 1 74419612 missense probably damaging 1.00
PIT4362001:Vil1 UTSW 1 74421383 missense probably damaging 1.00
R0104:Vil1 UTSW 1 74418366 missense probably benign 0.44
R0241:Vil1 UTSW 1 74426694 missense probably damaging 1.00
R0241:Vil1 UTSW 1 74426694 missense probably damaging 1.00
R0496:Vil1 UTSW 1 74421340 missense possibly damaging 0.88
R1329:Vil1 UTSW 1 74427558 missense probably benign 0.00
R1824:Vil1 UTSW 1 74418447 missense probably benign 0.00
R1916:Vil1 UTSW 1 74418525 missense probably benign
R2188:Vil1 UTSW 1 74427565 missense probably benign 0.22
R2216:Vil1 UTSW 1 74425679 missense probably benign 0.05
R3808:Vil1 UTSW 1 74427613 missense probably benign
R3939:Vil1 UTSW 1 74432415 missense probably benign 0.09
R4288:Vil1 UTSW 1 74418525 missense probably benign
R4648:Vil1 UTSW 1 74432298 missense probably benign
R4748:Vil1 UTSW 1 74421266 missense probably damaging 1.00
R5333:Vil1 UTSW 1 74432390 missense probably benign
R5429:Vil1 UTSW 1 74432331 missense probably benign 0.05
R5973:Vil1 UTSW 1 74416033 missense possibly damaging 0.93
R6007:Vil1 UTSW 1 74419867 missense probably damaging 1.00
R6247:Vil1 UTSW 1 74432339 missense probably benign
R6306:Vil1 UTSW 1 74421311 missense possibly damaging 0.90
R6989:Vil1 UTSW 1 74423954 missense probably damaging 0.99
R7112:Vil1 UTSW 1 74416002 missense probably damaging 1.00
R7320:Vil1 UTSW 1 74418444 missense probably damaging 1.00
R7481:Vil1 UTSW 1 74419899 missense probably damaging 1.00
R7553:Vil1 UTSW 1 74426732 critical splice donor site probably null
R7709:Vil1 UTSW 1 74426595 missense probably benign 0.39
R8159:Vil1 UTSW 1 74423977 missense probably benign 0.00
R8190:Vil1 UTSW 1 74434893 nonsense probably null
Z1176:Vil1 UTSW 1 74428232 missense probably damaging 0.98
Z1177:Vil1 UTSW 1 74415132 missense probably damaging 1.00
Z1177:Vil1 UTSW 1 74421430 missense probably benign
Predicted Primers PCR Primer
(F):5'- AGGTCTTTCTAGCTGGGCATC -3'
(R):5'- AAGGCTAGTGGCATCTGGAC -3'

Sequencing Primer
(F):5'- CTAGCTGGGCATCGGGGATG -3'
(R):5'- GGATTGTGCCATGAAGCTACC -3'
Posted On2019-11-26