Incidental Mutation 'R7791:Tsc1'
ID 599860
Institutional Source Beutler Lab
Gene Symbol Tsc1
Ensembl Gene ENSMUSG00000026812
Gene Name TSC complex subunit 1
Synonyms tuberous sclerosis 1, hamartin
MMRRC Submission 045847-MU
Accession Numbers
Essential gene? Essential (E-score: 1.000) question?
Stock # R7791 (G1)
Quality Score 225.009
Status Validated
Chromosome 2
Chromosomal Location 28531240-28581179 bp(+) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) T to C at 28571960 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Phenylalanine to Leucine at position 844 (F844L)
Ref Sequence ENSEMBL: ENSMUSP00000109500 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000028155] [ENSMUST00000113867] [ENSMUST00000113869] [ENSMUST00000113870] [ENSMUST00000133565]
AlphaFold Q9EP53
Predicted Effect probably damaging
Transcript: ENSMUST00000028155
AA Change: F843L

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000028155
Gene: ENSMUSG00000026812
AA Change: F843L

DomainStartEndE-ValueType
Pfam:Hamartin 2 715 2.2e-281 PFAM
SCOP:d1eq1a_ 723 886 4e-11 SMART
low complexity region 974 990 N/A INTRINSIC
low complexity region 1025 1042 N/A INTRINSIC
low complexity region 1099 1117 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000113867
AA Change: F838L

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000109498
Gene: ENSMUSG00000026812
AA Change: F838L

DomainStartEndE-ValueType
Pfam:Hamartin 2 710 7.3e-279 PFAM
SCOP:d1eq1a_ 718 881 6e-11 SMART
low complexity region 969 985 N/A INTRINSIC
low complexity region 1020 1037 N/A INTRINSIC
low complexity region 1094 1112 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000113869
AA Change: F844L

PolyPhen 2 Score 0.998 (Sensitivity: 0.27; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000109500
Gene: ENSMUSG00000026812
AA Change: F844L

DomainStartEndE-ValueType
Pfam:Hamartin 7 716 6e-279 PFAM
SCOP:d1eq1a_ 724 887 4e-11 SMART
low complexity region 975 991 N/A INTRINSIC
low complexity region 1026 1043 N/A INTRINSIC
low complexity region 1100 1118 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000113870
AA Change: F843L

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000109501
Gene: ENSMUSG00000026812
AA Change: F843L

DomainStartEndE-ValueType
Pfam:Hamartin 2 715 2.2e-281 PFAM
SCOP:d1eq1a_ 723 886 4e-11 SMART
low complexity region 974 990 N/A INTRINSIC
low complexity region 1025 1042 N/A INTRINSIC
low complexity region 1099 1117 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000133565
SMART Domains Protein: ENSMUSP00000120888
Gene: ENSMUSG00000026812

DomainStartEndE-ValueType
Pfam:Hamartin 2 455 1.3e-198 PFAM
Meta Mutation Damage Score 0.0608 question?
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.6%
  • 20x: 98.8%
Validation Efficiency 100% (51/51)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a growth inhibitory protein thought to play a role in the stabilization of tuberin. Mutations in this gene have been associated with tuberous sclerosis. Alternative splicing results in multiple transcript variants. [provided by RefSeq, Jun 2009]
PHENOTYPE: Homozygous null mutants show liver hypoplasia, open neural tube and die by embryonic day 10.5-11.5. Heterozygotes develop kidney cystadenomas and liver hemangiomas. Conditional astrocyte-specific nulls show increased astrocyte numbers and seizures. [provided by MGI curators]
Allele List at MGI

All alleles(38) : Targeted(7) Gene trapped(31)

Other mutations in this stock
Total: 51 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4921517D22Rik A T 13: 59,838,508 (GRCm39) M108K probably benign Het
AAdacl4fm3 A G 4: 144,430,015 (GRCm39) S325P probably damaging Het
Adamts9 A T 6: 92,849,366 (GRCm39) V1031D probably benign Het
Agap3 C T 5: 24,681,411 (GRCm39) R122C probably damaging Het
Arhgap27 A G 11: 103,230,020 (GRCm39) probably null Het
Atp1a2 T A 1: 172,103,782 (GRCm39) I950F probably benign Het
Bahcc1 T G 11: 120,159,203 (GRCm39) H143Q probably damaging Het
Bcl7b T A 5: 135,199,968 (GRCm39) D40E probably damaging Het
C9 C T 15: 6,519,359 (GRCm39) R399C possibly damaging Het
Capn13 T C 17: 73,689,883 (GRCm39) I43V possibly damaging Het
Ctcf A G 8: 106,391,571 (GRCm39) T289A possibly damaging Het
Cux2 T C 5: 122,005,162 (GRCm39) N1008S probably benign Het
Dst T A 1: 34,193,673 (GRCm39) M294K probably damaging Het
Eml4 G T 17: 83,781,135 (GRCm39) D778Y probably benign Het
Exoc3l4 A C 12: 111,389,974 (GRCm39) D183A probably damaging Het
Eya4 A T 10: 22,989,825 (GRCm39) S511T probably damaging Het
Fbrsl1 T C 5: 110,595,885 (GRCm39) H50R probably benign Het
Gemin5 G A 11: 58,015,819 (GRCm39) P1396S probably benign Het
Gnb4 A G 3: 32,644,192 (GRCm39) F151L possibly damaging Het
Gnptab A G 10: 88,276,084 (GRCm39) probably null Het
Gpbp1l1 T A 4: 116,431,617 (GRCm39) W92R probably damaging Het
Gucy1b1 A T 3: 81,942,704 (GRCm39) Y479* probably null Het
Htr3a T A 9: 48,812,875 (GRCm39) Q188L possibly damaging Het
Ighv5-9-1 A G 12: 113,700,165 (GRCm39) F18S probably damaging Het
Loxhd1 A G 18: 77,471,425 (GRCm39) T1004A probably damaging Het
Mansc4 G A 6: 146,983,042 (GRCm39) L132F unknown Het
Mmp1a TG TGG 9: 7,465,083 (GRCm38) probably null Het
Mtor G T 4: 148,547,397 (GRCm39) R460L probably benign Het
Mtus1 A T 8: 41,536,417 (GRCm39) F433Y possibly damaging Het
Myoc T C 1: 162,476,690 (GRCm39) Y465H probably damaging Het
N4bp1 A G 8: 87,579,831 (GRCm39) V657A probably damaging Het
Ndufv1 A T 19: 4,061,533 (GRCm39) probably null Het
Nectin1 T C 9: 43,703,336 (GRCm39) I198T probably benign Het
Or10h1 T A 17: 33,418,326 (GRCm39) C101* probably null Het
Or8g20 T C 9: 39,396,177 (GRCm39) D124G probably damaging Het
Padi2 C T 4: 140,644,907 (GRCm39) T47I probably benign Het
Pdia4 A T 6: 47,784,056 (GRCm39) I116N probably damaging Het
Pkdrej T A 15: 85,700,132 (GRCm39) I1935L possibly damaging Het
Pnpla7 C A 2: 24,942,078 (GRCm39) A1173D probably damaging Het
Ralgapa1 A T 12: 55,788,304 (GRCm39) L593Q probably damaging Het
Scn5a A G 9: 119,372,402 (GRCm39) S231P possibly damaging Het
Slc13a2 A G 11: 78,312,890 (GRCm39) probably null Het
Spdl1 A G 11: 34,704,304 (GRCm39) S510P possibly damaging Het
Tbxa2r G T 10: 81,170,540 (GRCm39) *342L probably null Het
Tfrc A G 16: 32,437,985 (GRCm39) K346R probably benign Het
Tmem52b A G 6: 129,489,966 (GRCm39) probably benign Het
Ttc39a A G 4: 109,283,544 (GRCm39) N158S probably benign Het
Ulk4 C T 9: 121,092,734 (GRCm39) E168K possibly damaging Het
Vgf T C 5: 137,060,885 (GRCm39) L349P unknown Het
Vil1 T C 1: 74,467,295 (GRCm39) Y681H probably damaging Het
Zfp654 A G 16: 64,603,634 (GRCm39) *572R probably null Het
Other mutations in Tsc1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00333:Tsc1 APN 2 28,551,623 (GRCm39) missense probably damaging 0.98
IGL00770:Tsc1 APN 2 28,555,023 (GRCm39) missense probably damaging 1.00
IGL00774:Tsc1 APN 2 28,555,023 (GRCm39) missense probably damaging 1.00
IGL00835:Tsc1 APN 2 28,562,478 (GRCm39) missense possibly damaging 0.93
IGL00971:Tsc1 APN 2 28,560,952 (GRCm39) nonsense probably null
IGL01808:Tsc1 APN 2 28,552,519 (GRCm39) missense probably damaging 1.00
IGL02281:Tsc1 APN 2 28,553,607 (GRCm39) missense probably damaging 1.00
IGL03068:Tsc1 APN 2 28,571,270 (GRCm39) missense probably damaging 1.00
Cassava UTSW 2 28,561,898 (GRCm39) splice site probably null
R0077:Tsc1 UTSW 2 28,568,955 (GRCm39) splice site probably benign
R0149:Tsc1 UTSW 2 28,560,913 (GRCm39) missense probably damaging 0.99
R0605:Tsc1 UTSW 2 28,561,790 (GRCm39) missense probably damaging 1.00
R0737:Tsc1 UTSW 2 28,560,942 (GRCm39) missense possibly damaging 0.94
R1199:Tsc1 UTSW 2 28,555,638 (GRCm39) missense probably damaging 1.00
R1751:Tsc1 UTSW 2 28,566,038 (GRCm39) missense probably damaging 0.97
R1757:Tsc1 UTSW 2 28,576,125 (GRCm39) missense probably benign 0.05
R1807:Tsc1 UTSW 2 28,576,125 (GRCm39) missense probably benign 0.05
R2014:Tsc1 UTSW 2 28,555,649 (GRCm39) splice site probably benign
R2284:Tsc1 UTSW 2 28,555,109 (GRCm39) missense possibly damaging 0.85
R3786:Tsc1 UTSW 2 28,577,154 (GRCm39) missense probably damaging 1.00
R4490:Tsc1 UTSW 2 28,560,937 (GRCm39) missense probably damaging 0.97
R4707:Tsc1 UTSW 2 28,562,419 (GRCm39) missense probably damaging 1.00
R4751:Tsc1 UTSW 2 28,569,093 (GRCm39) missense probably damaging 0.96
R4794:Tsc1 UTSW 2 28,551,702 (GRCm39) splice site probably null
R4906:Tsc1 UTSW 2 28,565,201 (GRCm39) missense possibly damaging 0.81
R5020:Tsc1 UTSW 2 28,566,531 (GRCm39) missense probably damaging 1.00
R5401:Tsc1 UTSW 2 28,576,920 (GRCm39) nonsense probably null
R5708:Tsc1 UTSW 2 28,555,197 (GRCm39) intron probably benign
R6435:Tsc1 UTSW 2 28,566,464 (GRCm39) missense probably benign 0.08
R6469:Tsc1 UTSW 2 28,561,898 (GRCm39) splice site probably null
R6502:Tsc1 UTSW 2 28,555,613 (GRCm39) missense probably damaging 1.00
R6617:Tsc1 UTSW 2 28,577,001 (GRCm39) missense possibly damaging 0.82
R7098:Tsc1 UTSW 2 28,565,744 (GRCm39) missense probably benign 0.00
R7503:Tsc1 UTSW 2 28,577,088 (GRCm39) missense possibly damaging 0.50
R7608:Tsc1 UTSW 2 28,548,748 (GRCm39) missense probably benign 0.01
R7677:Tsc1 UTSW 2 28,562,829 (GRCm39) missense probably benign 0.11
R8021:Tsc1 UTSW 2 28,576,901 (GRCm39) missense possibly damaging 0.67
R8203:Tsc1 UTSW 2 28,563,007 (GRCm39) splice site probably null
R8228:Tsc1 UTSW 2 28,566,141 (GRCm39) missense probably benign 0.23
R9057:Tsc1 UTSW 2 28,575,874 (GRCm39) missense probably damaging 1.00
R9088:Tsc1 UTSW 2 28,552,617 (GRCm39) missense possibly damaging 0.94
R9201:Tsc1 UTSW 2 28,576,791 (GRCm39) missense probably benign
R9386:Tsc1 UTSW 2 28,561,858 (GRCm39) missense probably benign
R9731:Tsc1 UTSW 2 28,566,486 (GRCm39) missense probably benign 0.00
R9780:Tsc1 UTSW 2 28,565,761 (GRCm39) missense probably damaging 0.98
Predicted Primers PCR Primer
(F):5'- CAACCTCAGTGTGTTTCTGC -3'
(R):5'- ATGTCTTCCTGTGCCTGGAC -3'

Sequencing Primer
(F):5'- AGTGTGTTTCTGCTGCCC -3'
(R):5'- TGTGCCTGGACACTGCAATG -3'
Posted On 2019-11-26