Incidental Mutation 'R7791:Gpbp1l1'
ID 599864
Institutional Source Beutler Lab
Gene Symbol Gpbp1l1
Ensembl Gene ENSMUSG00000034042
Gene Name GC-rich promoter binding protein 1-like 1
Synonyms 5330440M15Rik
MMRRC Submission 045847-MU
Accession Numbers
Essential gene? Non essential (E-score: 0.000) question?
Stock # R7791 (G1)
Quality Score 225.009
Status Validated
Chromosome 4
Chromosomal Location 116414855-116451079 bp(+) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) T to A at 116431617 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Tryptophan to Arginine at position 92 (W92R)
Ref Sequence ENSEMBL: ENSMUSP00000030460 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000030460] [ENSMUST00000106475]
AlphaFold Q6NZP2
Predicted Effect probably damaging
Transcript: ENSMUST00000030460
AA Change: W92R

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000030460
Gene: ENSMUSG00000034042
AA Change: W92R

DomainStartEndE-ValueType
low complexity region 204 219 N/A INTRINSIC
low complexity region 237 251 N/A INTRINSIC
low complexity region 289 320 N/A INTRINSIC
Pfam:Vasculin 376 470 5.1e-48 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000106475
AA Change: W92R

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000102083
Gene: ENSMUSG00000034042
AA Change: W92R

DomainStartEndE-ValueType
low complexity region 204 219 N/A INTRINSIC
low complexity region 237 251 N/A INTRINSIC
low complexity region 289 320 N/A INTRINSIC
Pfam:Vasculin 377 470 1.3e-44 PFAM
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.6%
  • 20x: 98.8%
Validation Efficiency 100% (51/51)
Allele List at MGI
Other mutations in this stock
Total: 51 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4921517D22Rik A T 13: 59,838,508 (GRCm39) M108K probably benign Het
AAdacl4fm3 A G 4: 144,430,015 (GRCm39) S325P probably damaging Het
Adamts9 A T 6: 92,849,366 (GRCm39) V1031D probably benign Het
Agap3 C T 5: 24,681,411 (GRCm39) R122C probably damaging Het
Arhgap27 A G 11: 103,230,020 (GRCm39) probably null Het
Atp1a2 T A 1: 172,103,782 (GRCm39) I950F probably benign Het
Bahcc1 T G 11: 120,159,203 (GRCm39) H143Q probably damaging Het
Bcl7b T A 5: 135,199,968 (GRCm39) D40E probably damaging Het
C9 C T 15: 6,519,359 (GRCm39) R399C possibly damaging Het
Capn13 T C 17: 73,689,883 (GRCm39) I43V possibly damaging Het
Ctcf A G 8: 106,391,571 (GRCm39) T289A possibly damaging Het
Cux2 T C 5: 122,005,162 (GRCm39) N1008S probably benign Het
Dst T A 1: 34,193,673 (GRCm39) M294K probably damaging Het
Eml4 G T 17: 83,781,135 (GRCm39) D778Y probably benign Het
Exoc3l4 A C 12: 111,389,974 (GRCm39) D183A probably damaging Het
Eya4 A T 10: 22,989,825 (GRCm39) S511T probably damaging Het
Fbrsl1 T C 5: 110,595,885 (GRCm39) H50R probably benign Het
Gemin5 G A 11: 58,015,819 (GRCm39) P1396S probably benign Het
Gnb4 A G 3: 32,644,192 (GRCm39) F151L possibly damaging Het
Gnptab A G 10: 88,276,084 (GRCm39) probably null Het
Gucy1b1 A T 3: 81,942,704 (GRCm39) Y479* probably null Het
Htr3a T A 9: 48,812,875 (GRCm39) Q188L possibly damaging Het
Ighv5-9-1 A G 12: 113,700,165 (GRCm39) F18S probably damaging Het
Loxhd1 A G 18: 77,471,425 (GRCm39) T1004A probably damaging Het
Mansc4 G A 6: 146,983,042 (GRCm39) L132F unknown Het
Mmp1a TG TGG 9: 7,465,083 (GRCm38) probably null Het
Mtor G T 4: 148,547,397 (GRCm39) R460L probably benign Het
Mtus1 A T 8: 41,536,417 (GRCm39) F433Y possibly damaging Het
Myoc T C 1: 162,476,690 (GRCm39) Y465H probably damaging Het
N4bp1 A G 8: 87,579,831 (GRCm39) V657A probably damaging Het
Ndufv1 A T 19: 4,061,533 (GRCm39) probably null Het
Nectin1 T C 9: 43,703,336 (GRCm39) I198T probably benign Het
Or10h1 T A 17: 33,418,326 (GRCm39) C101* probably null Het
Or8g20 T C 9: 39,396,177 (GRCm39) D124G probably damaging Het
Padi2 C T 4: 140,644,907 (GRCm39) T47I probably benign Het
Pdia4 A T 6: 47,784,056 (GRCm39) I116N probably damaging Het
Pkdrej T A 15: 85,700,132 (GRCm39) I1935L possibly damaging Het
Pnpla7 C A 2: 24,942,078 (GRCm39) A1173D probably damaging Het
Ralgapa1 A T 12: 55,788,304 (GRCm39) L593Q probably damaging Het
Scn5a A G 9: 119,372,402 (GRCm39) S231P possibly damaging Het
Slc13a2 A G 11: 78,312,890 (GRCm39) probably null Het
Spdl1 A G 11: 34,704,304 (GRCm39) S510P possibly damaging Het
Tbxa2r G T 10: 81,170,540 (GRCm39) *342L probably null Het
Tfrc A G 16: 32,437,985 (GRCm39) K346R probably benign Het
Tmem52b A G 6: 129,489,966 (GRCm39) probably benign Het
Tsc1 T C 2: 28,571,960 (GRCm39) F844L probably damaging Het
Ttc39a A G 4: 109,283,544 (GRCm39) N158S probably benign Het
Ulk4 C T 9: 121,092,734 (GRCm39) E168K possibly damaging Het
Vgf T C 5: 137,060,885 (GRCm39) L349P unknown Het
Vil1 T C 1: 74,467,295 (GRCm39) Y681H probably damaging Het
Zfp654 A G 16: 64,603,634 (GRCm39) *572R probably null Het
Other mutations in Gpbp1l1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00926:Gpbp1l1 APN 4 116,444,710 (GRCm39) critical splice donor site probably null
IGL03342:Gpbp1l1 APN 4 116,431,740 (GRCm39) missense probably benign
R0534:Gpbp1l1 UTSW 4 116,448,465 (GRCm39) missense probably damaging 1.00
R0964:Gpbp1l1 UTSW 4 116,438,436 (GRCm39) splice site probably benign
R1136:Gpbp1l1 UTSW 4 116,450,115 (GRCm39) missense probably damaging 1.00
R1169:Gpbp1l1 UTSW 4 116,431,563 (GRCm39) missense possibly damaging 0.53
R3975:Gpbp1l1 UTSW 4 116,428,182 (GRCm39) critical splice donor site probably null
R4296:Gpbp1l1 UTSW 4 116,444,656 (GRCm39) missense possibly damaging 0.80
R4676:Gpbp1l1 UTSW 4 116,447,462 (GRCm39) missense probably damaging 1.00
R4870:Gpbp1l1 UTSW 4 116,430,714 (GRCm39) missense probably benign
R5086:Gpbp1l1 UTSW 4 116,445,789 (GRCm39) missense probably benign 0.04
R5931:Gpbp1l1 UTSW 4 116,447,457 (GRCm39) missense probably benign 0.00
R6486:Gpbp1l1 UTSW 4 116,438,572 (GRCm39) missense probably damaging 0.99
R6604:Gpbp1l1 UTSW 4 116,430,702 (GRCm39) missense probably benign 0.09
R6973:Gpbp1l1 UTSW 4 116,438,479 (GRCm39) missense possibly damaging 0.53
R7031:Gpbp1l1 UTSW 4 116,450,045 (GRCm39) missense probably damaging 1.00
R7230:Gpbp1l1 UTSW 4 116,445,807 (GRCm39) missense probably damaging 0.99
R7286:Gpbp1l1 UTSW 4 116,447,442 (GRCm39) missense probably benign 0.02
R7368:Gpbp1l1 UTSW 4 116,430,655 (GRCm39) missense probably benign 0.04
R9475:Gpbp1l1 UTSW 4 116,431,558 (GRCm39) missense possibly damaging 0.87
Predicted Primers PCR Primer
(F):5'- ATTGTCTCACAAAGCATGGTG -3'
(R):5'- GAAGTCTTCCTCTTCAAACTGCAAC -3'

Sequencing Primer
(F):5'- GCCTTTTTGGAAGTAACTTTGACC -3'
(R):5'- CAAACTGCAACTTTTCTACTTTATCC -3'
Posted On 2019-11-26