Mutagenetix > Incidental Mutation

Incidental Mutation 'R7791:Adamts9'

599874

Institutional Source

Beutler Lab

Gene Symbol

Adamts9

Ensembl Gene

ENSMUSG00000030022

Gene Name

a disintegrin-like and metallopeptidase (reprolysin type) with thrombospondin type 1 motif, 9

Synonyms

8430403M15Rik, E030027K14Rik, 1810011L16Rik

MMRRC Submission

Accession Numbers

Essential gene?

Essential (E-score: 1.000) question?

Stock #

R7791 (G1)

Quality Score

225.009

Status

Validated

Chromosome

Chromosomal Location

92772699-92943492 bp(-) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

A to T at 92872385 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Valine to Aspartic acid at position 1031 (V1031D)

Ref Sequence

ENSEMBL: ENSMUSP00000109065 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000113434] [ENSMUST00000113438] [ENSMUST00000167391]

AlphaFold

E9PUN6

Predicted Effect

probably benign
Transcript: ENSMUST00000113434

Predicted Effect

probably benign
Transcript: ENSMUST00000113438
AA Change: V1031D

PolyPhen 2 Score 0.003 (Sensitivity: 0.98; Specificity: 0.44)

SMART Domains

Protein: ENSMUSP00000109065
Gene: ENSMUSG00000030022
AA Change: V1031D

Domain	Start	End	E-Value	Type
signal peptide	1	20	N/A	INTRINSIC
Pfam:Pep_M12B_propep	49	207	1.8e-37	PFAM
low complexity region	234	247	N/A	INTRINSIC
Pfam:Reprolysin_5	291	476	7.6e-17	PFAM
Pfam:Reprolysin_4	291	495	2e-11	PFAM
Pfam:Reprolysin	293	499	7.4e-29	PFAM
Pfam:Reprolysin_2	310	489	1e-13	PFAM
Pfam:Reprolysin_3	314	445	1.7e-14	PFAM
TSP1	591	643	2.15e-9	SMART
Pfam:ADAM_spacer1	753	871	7.3e-35	PFAM
TSP1	881	936	1.14e0	SMART
Blast:TSP1	938	993	2e-28	BLAST
TSP1	1000	1054	3.78e-5	SMART
TSP1	1055	1109	5.64e-4	SMART
TSP1	1110	1166	1.25e-5	SMART
TSP1	1186	1240	1.45e-6	SMART
TSP1	1242	1296	4.41e-6	SMART
TSP1	1328	1380	7.06e-5	SMART
TSP1	1381	1436	4.24e-8	SMART
TSP1	1440	1495	8.23e-6	SMART
TSP1	1496	1551	1.23e-4	SMART
TSP1	1552	1609	2e-4	SMART
TSP1	1611	1672	1.25e-5	SMART
TSP1	1676	1730	3.47e-4	SMART
Pfam:GON	1732	1930	1.6e-85	PFAM

Predicted Effect

probably benign
Transcript: ENSMUST00000167391
AA Change: V450D

PolyPhen 2 Score 0.003 (Sensitivity: 0.98; Specificity: 0.44)

SMART Domains

Protein: ENSMUSP00000126498
Gene: ENSMUSG00000030022
AA Change: V450D

Domain	Start	End	E-Value	Type
TSP1	10	62	2.15e-9	SMART
Pfam:ADAM_spacer1	172	290	6.1e-35	PFAM
TSP1	300	355	1.14e0	SMART
Blast:TSP1	357	412	3e-28	BLAST
TSP1	419	473	3.78e-5	SMART
TSP1	474	528	5.64e-4	SMART
TSP1	529	585	1.25e-5	SMART
TSP1	605	659	1.45e-6	SMART
TSP1	661	715	4.41e-6	SMART
TSP1	747	799	7.06e-5	SMART
TSP1	800	855	4.24e-8	SMART
TSP1	859	914	8.23e-6	SMART
TSP1	915	970	1.23e-4	SMART
TSP1	971	1028	2e-4	SMART
TSP1	1030	1091	1.25e-5	SMART
TSP1	1095	1149	3.47e-4	SMART
Pfam:GON	1150	1350	2.1e-86	PFAM

Meta Mutation Damage Score

0.0898

Coding Region Coverage

1x: 100.0%
3x: 99.9%
10x: 99.6%
20x: 98.8%

Validation Efficiency

100% (51/51)

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of the ADAMTS (a disintegrin and metalloproteinase with thrombospondin motifs) protein family. Members of the family share several distinct protein modules, including a propeptide region, a metalloproteinase domain, a disintegrin-like domain, and a thrombospondin type 1 (TS) motif. Individual members of this family differ in the number of C-terminal TS motifs, and some have unique C-terminal domains. Members of the ADAMTS family have been implicated in the cleavage of proteoglycans, the control of organ shape during development, and the inhibition of angiogenesis. This gene is localized to chromosome 3p14.3-p14.2, an area known to be lost in hereditary renal tumors. Alternative splicing results in multiple transcript variants encoding different isoforms that may undergo similar proteolytic processing. [provided by RefSeq, Jan 2016]
PHENOTYPE: Homozygous null mice display embryonic lethality before somite formation. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 51 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
4921517D22Rik	A	T	13: 59,690,694	M108K	probably benign	Het
Agap3	C	T	5: 24,476,413	R122C	probably damaging	Het
Arhgap27	A	G	11: 103,339,194		probably null	Het
Atp1a2	T	A	1: 172,276,215	I950F	probably benign	Het
Bahcc1	T	G	11: 120,268,377	H143Q	probably damaging	Het
Bcl7b	T	A	5: 135,171,114	D40E	probably damaging	Het
C9	C	T	15: 6,489,878	R399C	possibly damaging	Het
Capn13	T	C	17: 73,382,888	I43V	possibly damaging	Het
Ctcf	A	G	8: 105,664,939	T289A	possibly damaging	Het
Cux2	T	C	5: 121,867,099	N1008S	probably benign	Het
Dst	T	A	1: 34,154,592	M294K	probably damaging	Het
Eml4	G	T	17: 83,473,706	D778Y	probably benign	Het
Exoc3l4	A	C	12: 111,423,540	D183A	probably damaging	Het
Eya4	A	T	10: 23,113,926	S511T	probably damaging	Het
Fbrsl1	T	C	5: 110,448,019	H50R	probably benign	Het
Gemin5	G	A	11: 58,124,993	P1396S	probably benign	Het
Gm13178	A	G	4: 144,703,445	S325P	probably damaging	Het
Gnb4	A	G	3: 32,590,043	F151L	possibly damaging	Het
Gnptab	A	G	10: 88,440,222		probably null	Het
Gpbp1l1	T	A	4: 116,574,420	W92R	probably damaging	Het
Gucy1b1	A	T	3: 82,035,397	Y479*	probably null	Het
Htr3a	T	A	9: 48,901,575	Q188L	possibly damaging	Het
Ighv5-9-1	A	G	12: 113,736,545	F18S	probably damaging	Het
Loxhd1	A	G	18: 77,383,729	T1004A	probably damaging	Het
Mansc4	G	A	6: 147,081,544	L132F	unknown	Het
Mmp1a	TG	TGG	9: 7,465,083		probably null	Het
Mtor	G	T	4: 148,462,940	R460L	probably benign	Het
Mtus1	A	T	8: 41,083,380	F433Y	possibly damaging	Het
Myoc	T	C	1: 162,649,121	Y465H	probably damaging	Het
N4bp1	A	G	8: 86,853,203	V657A	probably damaging	Het
Ndufv1	A	T	19: 4,011,533		probably null	Het
Nectin1	T	C	9: 43,792,039	I198T	probably benign	Het
Olfr239	T	A	17: 33,199,352	C101*	probably null	Het
Olfr44	T	C	9: 39,484,881	D124G	probably damaging	Het
Padi2	C	T	4: 140,917,596	T47I	probably benign	Het
Pdia4	A	T	6: 47,807,122	I116N	probably damaging	Het
Pkdrej	T	A	15: 85,815,931	I1935L	possibly damaging	Het
Pnpla7	C	A	2: 25,052,066	A1173D	probably damaging	Het
Ralgapa1	A	T	12: 55,741,519	L593Q	probably damaging	Het
Scn5a	A	G	9: 119,543,336	S231P	possibly damaging	Het
Slc13a2	A	G	11: 78,422,064		probably null	Het
Spdl1	A	G	11: 34,813,477	S510P	possibly damaging	Het
Tbxa2r	G	T	10: 81,334,706	*342L	probably null	Het
Tfrc	A	G	16: 32,619,167	K346R	probably benign	Het
Tmem52b	A	G	6: 129,513,003		probably benign	Het
Tsc1	T	C	2: 28,681,948	F844L	probably damaging	Het
Ttc39a	A	G	4: 109,426,347	N158S	probably benign	Het
Ulk4	C	T	9: 121,263,668	E168K	possibly damaging	Het
Vgf	T	C	5: 137,032,031	L349P	unknown	Het
Vil1	T	C	1: 74,428,136	Y681H	probably damaging	Het
Zfp654	A	G	16: 64,783,271	*572R	probably null	Het

Other mutations in Adamts9

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00565:Adamts9	APN	6	92859902	missense	possibly damaging	0.90
IGL01352:Adamts9	APN	6	92860174	missense	probably benign	0.00
IGL01462:Adamts9	APN	6	92894266	missense	probably benign	0.04
IGL01551:Adamts9	APN	6	92807020	missense	probably damaging	0.99
IGL01577:Adamts9	APN	6	92858147	splice site	probably benign
IGL01638:Adamts9	APN	6	92872428	missense	probably benign	0.19
IGL01757:Adamts9	APN	6	92796159	missense	probably damaging	1.00
IGL02102:Adamts9	APN	6	92777439	missense	probably benign	0.00
IGL02379:Adamts9	APN	6	92797033	missense	probably damaging	0.97
IGL02419:Adamts9	APN	6	92796997	missense	probably benign	0.04
IGL02554:Adamts9	APN	6	92880847	missense	probably benign	0.01
IGL02832:Adamts9	APN	6	92807175	missense	probably damaging	1.00
IGL03164:Adamts9	APN	6	92889937	missense	probably damaging	1.00
IGL03347:Adamts9	APN	6	92887432	nonsense	probably null
IGL03401:Adamts9	APN	6	92786868	missense	probably damaging	0.97
basilisk	UTSW	6	92860189	missense	probably benign	0.35
bluebeard	UTSW	6	92879959	nonsense	probably null
Serpent	UTSW	6	92908706	missense	probably damaging	1.00
PIT4402001:Adamts9	UTSW	6	92872347	missense	probably benign
PIT4458001:Adamts9	UTSW	6	92889905	missense	probably damaging	0.99
R0047:Adamts9	UTSW	6	92905306	unclassified	probably benign
R0047:Adamts9	UTSW	6	92905306	unclassified	probably benign
R0067:Adamts9	UTSW	6	92890167	missense	probably damaging	0.98
R0141:Adamts9	UTSW	6	92943085	missense	probably benign
R0326:Adamts9	UTSW	6	92858057	nonsense	probably null
R0396:Adamts9	UTSW	6	92798005	missense	probably benign	0.00
R0490:Adamts9	UTSW	6	92872866	missense	probably benign
R0504:Adamts9	UTSW	6	92912645	missense	probably damaging	1.00
R0620:Adamts9	UTSW	6	92858113	missense	possibly damaging	0.95
R0669:Adamts9	UTSW	6	92880957	missense	probably damaging	1.00
R0682:Adamts9	UTSW	6	92903802	missense	possibly damaging	0.80
R1412:Adamts9	UTSW	6	92796433	missense	probably benign
R1433:Adamts9	UTSW	6	92849290	critical splice donor site	probably null
R1558:Adamts9	UTSW	6	92908711	missense	possibly damaging	0.87
R1661:Adamts9	UTSW	6	92880623	missense	possibly damaging	0.92
R1801:Adamts9	UTSW	6	92863376	missense	probably benign	0.27
R1855:Adamts9	UTSW	6	92901369	splice site	probably benign
R1887:Adamts9	UTSW	6	92872788	critical splice donor site	probably null
R1934:Adamts9	UTSW	6	92943121	missense	possibly damaging	0.59
R1956:Adamts9	UTSW	6	92859849	missense	probably damaging	1.00
R1986:Adamts9	UTSW	6	92796394	missense	probably benign
R2370:Adamts9	UTSW	6	92860203	missense	probably damaging	0.99
R2376:Adamts9	UTSW	6	92912831	missense	probably benign
R2432:Adamts9	UTSW	6	92857900	missense	probably damaging	1.00
R2876:Adamts9	UTSW	6	92795910	splice site	probably benign
R3015:Adamts9	UTSW	6	92872932	missense	probably benign	0.05
R3611:Adamts9	UTSW	6	92869984	missense	probably benign	0.05
R4024:Adamts9	UTSW	6	92872784	splice site	probably benign
R4292:Adamts9	UTSW	6	92795996	missense	possibly damaging	0.95
R4403:Adamts9	UTSW	6	92859864	missense	probably damaging	1.00
R4574:Adamts9	UTSW	6	92879959	nonsense	probably null
R4677:Adamts9	UTSW	6	92816606	start codon destroyed	probably null
R5114:Adamts9	UTSW	6	92890273	missense	probably benign	0.03
R5260:Adamts9	UTSW	6	92807137	missense	probably benign	0.00
R5384:Adamts9	UTSW	6	92798018	missense	probably damaging	1.00
R5423:Adamts9	UTSW	6	92880697	missense	possibly damaging	0.84
R5497:Adamts9	UTSW	6	92854365	missense	probably damaging	1.00
R5629:Adamts9	UTSW	6	92798133	missense	probably damaging	1.00
R5943:Adamts9	UTSW	6	92903786	missense	probably benign	0.02
R6039:Adamts9	UTSW	6	92908546	missense	possibly damaging	0.95
R6039:Adamts9	UTSW	6	92908546	missense	possibly damaging	0.95
R6051:Adamts9	UTSW	6	92859926	missense	possibly damaging	0.83
R6051:Adamts9	UTSW	6	92890118	missense	probably damaging	1.00
R6082:Adamts9	UTSW	6	92889949	missense	probably damaging	1.00
R6192:Adamts9	UTSW	6	92797021	missense	probably damaging	1.00
R6291:Adamts9	UTSW	6	92890120	missense	probably damaging	1.00
R6502:Adamts9	UTSW	6	92872335	missense	probably damaging	1.00
R6818:Adamts9	UTSW	6	92905191	missense	probably damaging	1.00
R6848:Adamts9	UTSW	6	92863354	missense	possibly damaging	0.84
R7028:Adamts9	UTSW	6	92909793	nonsense	probably null
R7095:Adamts9	UTSW	6	92887691	missense	probably benign	0.39
R7287:Adamts9	UTSW	6	92890003	missense	possibly damaging	0.89
R7294:Adamts9	UTSW	6	92894289	missense	probably damaging	1.00
R7313:Adamts9	UTSW	6	92858121	missense	probably damaging	1.00
R7581:Adamts9	UTSW	6	92937338	missense	probably benign	0.00
R7682:Adamts9	UTSW	6	92880698	missense	possibly damaging	0.57
R7691:Adamts9	UTSW	6	92796238	missense	probably damaging	1.00
R7851:Adamts9	UTSW	6	92908706	missense	probably damaging	1.00
R7974:Adamts9	UTSW	6	92909687	critical splice donor site	probably null
R8224:Adamts9	UTSW	6	92796370	missense	probably damaging	0.96
R8328:Adamts9	UTSW	6	92890012	missense	probably benign	0.17
R8334:Adamts9	UTSW	6	92937244	splice site	probably null
R8559:Adamts9	UTSW	6	92807136	missense	probably benign	0.01
R8709:Adamts9	UTSW	6	92807163	missense	probably damaging	1.00
R8735:Adamts9	UTSW	6	92860067	intron	probably benign
R8739:Adamts9	UTSW	6	92854280	missense	probably benign	0.04
R9108:Adamts9	UTSW	6	92880740	missense	probably damaging	1.00
R9171:Adamts9	UTSW	6	92872400	missense	probably benign	0.03
R9198:Adamts9	UTSW	6	92860189	missense	probably benign	0.35
R9299:Adamts9	UTSW	6	92796995	missense	probably benign	0.00
R9300:Adamts9	UTSW	6	92887390	missense	probably benign	0.10
R9308:Adamts9	UTSW	6	92880894	missense	probably benign	0.03
R9325:Adamts9	UTSW	6	92872298	missense	probably benign	0.00
R9397:Adamts9	UTSW	6	92901463	missense	probably damaging	1.00
R9550:Adamts9	UTSW	6	92901448	missense	probably benign	0.00
R9623:Adamts9	UTSW	6	92880680	missense	probably benign	0.02
R9698:Adamts9	UTSW	6	92807140	missense	probably damaging	1.00
R9755:Adamts9	UTSW	6	92879941	missense	probably benign	0.15
RF013:Adamts9	UTSW	6	92943145	missense	possibly damaging	0.88
Z1177:Adamts9	UTSW	6	92854346	missense	probably damaging	0.99

Predicted Primers

PCR Primer
(F):5'- ACAGTAGTCTACACCTCCGC -3'
(R):5'- GCTCCCCAGGTTAATTTGTAATG -3'

Sequencing Primer
(F):5'- GTCTACACCTCCGCCCGAC -3'
(R):5'- CCCCAGGTTAATTTGTAATGTCTGAC -3'

Posted On

2019-11-26