Incidental Mutation 'R7791:Mansc4'
ID599876
Institutional Source Beutler Lab
Gene Symbol Mansc4
Ensembl Gene ENSMUSG00000072662
Gene NameMANSC domain containing 4
Synonyms
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.072) question?
Stock #R7791 (G1)
Quality Score225.009
Status Validated
Chromosome6
Chromosomal Location147075060-147087032 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) G to A at 147081544 bp
ZygosityHeterozygous
Amino Acid Change Leucine to Phenylalanine at position 132 (L132F)
Ref Sequence ENSEMBL: ENSMUSP00000144765 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000100780] [ENSMUST00000123367]
Predicted Effect probably benign
Transcript: ENSMUST00000100780
SMART Domains Protein: ENSMUSP00000098343
Gene: ENSMUSG00000072662

DomainStartEndE-ValueType
signal peptide 1 18 N/A INTRINSIC
MANEC 24 113 5.4e-34 SMART
low complexity region 263 274 N/A INTRINSIC
transmembrane domain 284 306 N/A INTRINSIC
Predicted Effect unknown
Transcript: ENSMUST00000123367
AA Change: L132F
SMART Domains Protein: ENSMUSP00000144765
Gene: ENSMUSG00000072662
AA Change: L132F

DomainStartEndE-ValueType
signal peptide 1 18 N/A INTRINSIC
MANEC 24 113 9.4e-40 SMART
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.6%
  • 20x: 98.8%
Validation Efficiency 100% (51/51)
Allele List at MGI
Other mutations in this stock
Total: 51 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4921517D22Rik A T 13: 59,690,694 M108K probably benign Het
Adamts9 A T 6: 92,872,385 V1031D probably benign Het
Agap3 C T 5: 24,476,413 R122C probably damaging Het
Arhgap27 A G 11: 103,339,194 probably null Het
Atp1a2 T A 1: 172,276,215 I950F probably benign Het
Bahcc1 T G 11: 120,268,377 H143Q probably damaging Het
Bcl7b T A 5: 135,171,114 D40E probably damaging Het
C9 C T 15: 6,489,878 R399C possibly damaging Het
Capn13 T C 17: 73,382,888 I43V possibly damaging Het
Ctcf A G 8: 105,664,939 T289A possibly damaging Het
Cux2 T C 5: 121,867,099 N1008S probably benign Het
Dst T A 1: 34,154,592 M294K probably damaging Het
Eml4 G T 17: 83,473,706 D778Y probably benign Het
Exoc3l4 A C 12: 111,423,540 D183A probably damaging Het
Eya4 A T 10: 23,113,926 S511T probably damaging Het
Fbrsl1 T C 5: 110,448,019 H50R probably benign Het
Gemin5 G A 11: 58,124,993 P1396S probably benign Het
Gm13178 A G 4: 144,703,445 S325P probably damaging Het
Gnb4 A G 3: 32,590,043 F151L possibly damaging Het
Gnptab A G 10: 88,440,222 probably null Het
Gpbp1l1 T A 4: 116,574,420 W92R probably damaging Het
Gucy1b1 A T 3: 82,035,397 Y479* probably null Het
Htr3a T A 9: 48,901,575 Q188L possibly damaging Het
Ighv5-9-1 A G 12: 113,736,545 F18S probably damaging Het
Loxhd1 A G 18: 77,383,729 T1004A probably damaging Het
Mmp1a TG TGG 9: 7,465,083 probably null Het
Mtor G T 4: 148,462,940 R460L probably benign Het
Mtus1 A T 8: 41,083,380 F433Y possibly damaging Het
Myoc T C 1: 162,649,121 Y465H probably damaging Het
N4bp1 A G 8: 86,853,203 V657A probably damaging Het
Ndufv1 A T 19: 4,011,533 probably null Het
Nectin1 T C 9: 43,792,039 I198T probably benign Het
Olfr239 T A 17: 33,199,352 C101* probably null Het
Olfr44 T C 9: 39,484,881 D124G probably damaging Het
Padi2 C T 4: 140,917,596 T47I probably benign Het
Pdia4 A T 6: 47,807,122 I116N probably damaging Het
Pkdrej T A 15: 85,815,931 I1935L possibly damaging Het
Pnpla7 C A 2: 25,052,066 A1173D probably damaging Het
Ralgapa1 A T 12: 55,741,519 L593Q probably damaging Het
Scn5a A G 9: 119,543,336 S231P possibly damaging Het
Slc13a2 A G 11: 78,422,064 probably null Het
Spdl1 A G 11: 34,813,477 S510P possibly damaging Het
Tbxa2r G T 10: 81,334,706 *342L probably null Het
Tfrc A G 16: 32,619,167 K346R probably benign Het
Tmem52b A G 6: 129,513,003 probably benign Het
Tsc1 T C 2: 28,681,948 F844L probably damaging Het
Ttc39a A G 4: 109,426,347 N158S probably benign Het
Ulk4 C T 9: 121,263,668 E168K possibly damaging Het
Vgf T C 5: 137,032,031 L349P unknown Het
Vil1 T C 1: 74,428,136 Y681H probably damaging Het
Zfp654 A G 16: 64,783,271 *572R probably null Het
Other mutations in Mansc4
AlleleSourceChrCoordTypePredicted EffectPPH Score
R0115:Mansc4 UTSW 6 147075227 missense possibly damaging 0.63
R0481:Mansc4 UTSW 6 147075227 missense possibly damaging 0.63
R1550:Mansc4 UTSW 6 147075638 missense probably damaging 0.99
R1670:Mansc4 UTSW 6 147075191 missense possibly damaging 0.46
R1874:Mansc4 UTSW 6 147075190 missense probably benign 0.01
R1981:Mansc4 UTSW 6 147075675 missense probably benign 0.45
R1982:Mansc4 UTSW 6 147075675 missense probably benign 0.45
R4032:Mansc4 UTSW 6 147075180 missense probably benign 0.19
R5677:Mansc4 UTSW 6 147081549 missense probably benign 0.00
R6525:Mansc4 UTSW 6 147075147 missense probably benign 0.41
R6534:Mansc4 UTSW 6 147086873 missense probably damaging 1.00
R7197:Mansc4 UTSW 6 147075705 missense probably damaging 1.00
Z1177:Mansc4 UTSW 6 147086961 missense unknown
Predicted Primers PCR Primer
(F):5'- CAGTTGTGCATAGTCTGTCATC -3'
(R):5'- CACAACTGATGGAAGCCAGG -3'

Sequencing Primer
(F):5'- AGTCTGTCATCTGGAATGAATGC -3'
(R):5'- AACGCTAAGCTGATTCCCTTGG -3'
Posted On2019-11-26