Incidental Mutation 'R7791:Eya4'
ID599886
Institutional Source Beutler Lab
Gene Symbol Eya4
Ensembl Gene ENSMUSG00000010461
Gene NameEYA transcriptional coactivator and phosphatase 4
SynonymsB130023L16Rik
MMRRC Submission
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R7791 (G1)
Quality Score225.009
Status Validated
Chromosome10
Chromosomal Location23102963-23350786 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to T at 23113926 bp
ZygosityHeterozygous
Amino Acid Change Serine to Threonine at position 511 (S511T)
Ref Sequence ENSEMBL: ENSMUSP00000090335 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000074366] [ENSMUST00000092665] [ENSMUST00000219315] [ENSMUST00000220299]
Predicted Effect probably benign
Transcript: ENSMUST00000074366
AA Change: S511T

PolyPhen 2 Score 0.019 (Sensitivity: 0.95; Specificity: 0.80)
SMART Domains Protein: ENSMUSP00000073970
Gene: ENSMUSG00000010461
AA Change: S511T

DomainStartEndE-ValueType
low complexity region 49 72 N/A INTRINSIC
low complexity region 231 243 N/A INTRINSIC
low complexity region 322 334 N/A INTRINSIC
PDB:4EGC|B 336 616 1e-163 PDB
Predicted Effect probably damaging
Transcript: ENSMUST00000092665
AA Change: S511T

PolyPhen 2 Score 0.995 (Sensitivity: 0.68; Specificity: 0.97)
SMART Domains Protein: ENSMUSP00000090335
Gene: ENSMUSG00000010461
AA Change: S511T

DomainStartEndE-ValueType
low complexity region 49 72 N/A INTRINSIC
low complexity region 231 243 N/A INTRINSIC
low complexity region 322 334 N/A INTRINSIC
PDB:4EGC|B 336 616 1e-172 PDB
Predicted Effect probably damaging
Transcript: ENSMUST00000219315
AA Change: S534T

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
Predicted Effect probably benign
Transcript: ENSMUST00000220299
AA Change: S511T

PolyPhen 2 Score 0.019 (Sensitivity: 0.95; Specificity: 0.80)
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.6%
  • 20x: 98.8%
Validation Efficiency 100% (51/51)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of the eyes absent (EYA) family of proteins. The encoded protein may act as a transcriptional activator through its protein phosphatase activity, and it may be important for eye development, and for continued function of the mature organ of Corti. Mutations in this gene are associated with postlingual, progressive, autosomal dominant hearing loss at the deafness, autosomal dominant non-syndromic sensorineural 10 locus. The encoded protein is also a putative oncogene that mediates DNA repair, apoptosis, and innate immunity following DNA damage, cellular damage, and viral attack. Defects in this gene are also associated with dilated cardiomyopathy 1J. Alternative splicing results in multiple transcript variants encoding distinct isoforms. [provided by RefSeq, Jul 2014]
PHENOTYPE: Homozygous null mice show strain background-dependent postnatal lethality, reduced body weight, male sterility, a delay in palate bone fusion, developmental defects in the eustachian tube and middle ear cavity, early-onset hearing deficits, and profound susceptibility to otitis media with effusion. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 51 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4921517D22Rik A T 13: 59,690,694 M108K probably benign Het
Adamts9 A T 6: 92,872,385 V1031D probably benign Het
Agap3 C T 5: 24,476,413 R122C probably damaging Het
Arhgap27 A G 11: 103,339,194 probably null Het
Atp1a2 T A 1: 172,276,215 I950F probably benign Het
Bahcc1 T G 11: 120,268,377 H143Q probably damaging Het
Bcl7b T A 5: 135,171,114 D40E probably damaging Het
C9 C T 15: 6,489,878 R399C possibly damaging Het
Capn13 T C 17: 73,382,888 I43V possibly damaging Het
Ctcf A G 8: 105,664,939 T289A possibly damaging Het
Cux2 T C 5: 121,867,099 N1008S probably benign Het
Dst T A 1: 34,154,592 M294K probably damaging Het
Eml4 G T 17: 83,473,706 D778Y probably benign Het
Exoc3l4 A C 12: 111,423,540 D183A probably damaging Het
Fbrsl1 T C 5: 110,448,019 H50R probably benign Het
Gemin5 G A 11: 58,124,993 P1396S probably benign Het
Gm13178 A G 4: 144,703,445 S325P probably damaging Het
Gnb4 A G 3: 32,590,043 F151L possibly damaging Het
Gnptab A G 10: 88,440,222 probably null Het
Gpbp1l1 T A 4: 116,574,420 W92R probably damaging Het
Gucy1b1 A T 3: 82,035,397 Y479* probably null Het
Htr3a T A 9: 48,901,575 Q188L possibly damaging Het
Ighv5-9-1 A G 12: 113,736,545 F18S probably damaging Het
Loxhd1 A G 18: 77,383,729 T1004A probably damaging Het
Mansc4 G A 6: 147,081,544 L132F unknown Het
Mmp1a TG TGG 9: 7,465,083 probably null Het
Mtor G T 4: 148,462,940 R460L probably benign Het
Mtus1 A T 8: 41,083,380 F433Y possibly damaging Het
Myoc T C 1: 162,649,121 Y465H probably damaging Het
N4bp1 A G 8: 86,853,203 V657A probably damaging Het
Ndufv1 A T 19: 4,011,533 probably null Het
Nectin1 T C 9: 43,792,039 I198T probably benign Het
Olfr239 T A 17: 33,199,352 C101* probably null Het
Olfr44 T C 9: 39,484,881 D124G probably damaging Het
Padi2 C T 4: 140,917,596 T47I probably benign Het
Pdia4 A T 6: 47,807,122 I116N probably damaging Het
Pkdrej T A 15: 85,815,931 I1935L possibly damaging Het
Pnpla7 C A 2: 25,052,066 A1173D probably damaging Het
Ralgapa1 A T 12: 55,741,519 L593Q probably damaging Het
Scn5a A G 9: 119,543,336 S231P possibly damaging Het
Slc13a2 A G 11: 78,422,064 probably null Het
Spdl1 A G 11: 34,813,477 S510P possibly damaging Het
Tbxa2r G T 10: 81,334,706 *342L probably null Het
Tfrc A G 16: 32,619,167 K346R probably benign Het
Tmem52b A G 6: 129,513,003 probably benign Het
Tsc1 T C 2: 28,681,948 F844L probably damaging Het
Ttc39a A G 4: 109,426,347 N158S probably benign Het
Ulk4 C T 9: 121,263,668 E168K possibly damaging Het
Vgf T C 5: 137,032,031 L349P unknown Het
Vil1 T C 1: 74,428,136 Y681H probably damaging Het
Zfp654 A G 16: 64,783,271 *572R probably null Het
Other mutations in Eya4
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00435:Eya4 APN 10 23159097 missense probably benign 0.17
IGL00507:Eya4 APN 10 23157536 nonsense probably null
IGL01324:Eya4 APN 10 23116551 critical splice donor site probably null
IGL01350:Eya4 APN 10 23113974 missense possibly damaging 0.88
IGL01397:Eya4 APN 10 23139999 missense probably benign 0.01
IGL02682:Eya4 APN 10 23116600 missense probably damaging 1.00
IGL02688:Eya4 APN 10 23159110 missense probably benign 0.01
IGL03071:Eya4 APN 10 23323073 missense probably benign 0.07
R0420:Eya4 UTSW 10 23155963 missense possibly damaging 0.85
R1688:Eya4 UTSW 10 23123861 missense probably damaging 1.00
R2312:Eya4 UTSW 10 23106264 missense probably damaging 1.00
R3029:Eya4 UTSW 10 23123878 missense probably benign
R3853:Eya4 UTSW 10 23116676 missense probably damaging 1.00
R3872:Eya4 UTSW 10 23155972 missense probably damaging 0.97
R4113:Eya4 UTSW 10 23155951 missense probably damaging 0.98
R4210:Eya4 UTSW 10 23226800 critical splice donor site probably null
R4457:Eya4 UTSW 10 23116668 missense probably damaging 1.00
R4691:Eya4 UTSW 10 23140068 missense probably benign 0.03
R4894:Eya4 UTSW 10 23109854 missense possibly damaging 0.55
R5345:Eya4 UTSW 10 23110048 missense probably benign 0.00
R5473:Eya4 UTSW 10 23163453 missense probably benign 0.02
R5547:Eya4 UTSW 10 23109854 missense possibly damaging 0.55
R5698:Eya4 UTSW 10 23140077 missense possibly damaging 0.50
R5951:Eya4 UTSW 10 23155994 missense probably damaging 1.00
R5953:Eya4 UTSW 10 23151973 missense probably damaging 1.00
R6111:Eya4 UTSW 10 23140055 missense possibly damaging 0.67
R6413:Eya4 UTSW 10 23116826 missense probably damaging 1.00
R6460:Eya4 UTSW 10 23152012 missense probably benign 0.05
R7144:Eya4 UTSW 10 23173045 missense probably benign 0.00
R7169:Eya4 UTSW 10 23155947 missense probably benign 0.42
R7358:Eya4 UTSW 10 23123851 critical splice donor site probably null
R7549:Eya4 UTSW 10 23111658 missense probably damaging 1.00
R7793:Eya4 UTSW 10 23226816 missense probably benign
Z1088:Eya4 UTSW 10 23113988 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- TCTTATGCACCAGCCATCG -3'
(R):5'- GAAGGGACACCAAACTTCCTATTC -3'

Sequencing Primer
(F):5'- GTACCCATGCAGGCACACATAG -3'
(R):5'- ATTCCAGAGGCAGTGTTCAC -3'
Posted On2019-11-26