Incidental Mutation 'R7791:Spdl1'
ID599889
Institutional Source Beutler Lab
Gene Symbol Spdl1
Ensembl Gene ENSMUSG00000069910
Gene Namespindle apparatus coiled-coil protein 1
Synonyms
MMRRC Submission
Accession Numbers
Is this an essential gene? Probably essential (E-score: 0.891) question?
Stock #R7791 (G1)
Quality Score225.009
Status Validated
Chromosome11
Chromosomal Location34809190-34833641 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 34813477 bp
ZygosityHeterozygous
Amino Acid Change Serine to Proline at position 510 (S510P)
Ref Sequence ENSEMBL: ENSMUSP00000090882 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000093191]
Predicted Effect possibly damaging
Transcript: ENSMUST00000093191
AA Change: S510P

PolyPhen 2 Score 0.827 (Sensitivity: 0.84; Specificity: 0.93)
SMART Domains Protein: ENSMUSP00000090882
Gene: ENSMUSG00000069910
AA Change: S510P

DomainStartEndE-ValueType
coiled coil region 35 342 N/A INTRINSIC
coiled coil region 370 441 N/A INTRINSIC
low complexity region 463 478 N/A INTRINSIC
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.6%
  • 20x: 98.8%
Validation Efficiency 100% (51/51)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a coiled-coil domain-containing protein that functions in mitotic spindle formation and chromosome segregation. The encoded protein plays a role in coordinating microtubule attachment by promoting recruitment of dynein proteins, and in mitotic checkpoint signaling. [provided by RefSeq, Jul 2016]
Allele List at MGI
Other mutations in this stock
Total: 51 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4921517D22Rik A T 13: 59,690,694 M108K probably benign Het
Adamts9 A T 6: 92,872,385 V1031D probably benign Het
Agap3 C T 5: 24,476,413 R122C probably damaging Het
Arhgap27 A G 11: 103,339,194 probably null Het
Atp1a2 T A 1: 172,276,215 I950F probably benign Het
Bahcc1 T G 11: 120,268,377 H143Q probably damaging Het
Bcl7b T A 5: 135,171,114 D40E probably damaging Het
C9 C T 15: 6,489,878 R399C possibly damaging Het
Capn13 T C 17: 73,382,888 I43V possibly damaging Het
Ctcf A G 8: 105,664,939 T289A possibly damaging Het
Cux2 T C 5: 121,867,099 N1008S probably benign Het
Dst T A 1: 34,154,592 M294K probably damaging Het
Eml4 G T 17: 83,473,706 D778Y probably benign Het
Exoc3l4 A C 12: 111,423,540 D183A probably damaging Het
Eya4 A T 10: 23,113,926 S511T probably damaging Het
Fbrsl1 T C 5: 110,448,019 H50R probably benign Het
Gemin5 G A 11: 58,124,993 P1396S probably benign Het
Gm13178 A G 4: 144,703,445 S325P probably damaging Het
Gnb4 A G 3: 32,590,043 F151L possibly damaging Het
Gnptab A G 10: 88,440,222 probably null Het
Gpbp1l1 T A 4: 116,574,420 W92R probably damaging Het
Gucy1b1 A T 3: 82,035,397 Y479* probably null Het
Htr3a T A 9: 48,901,575 Q188L possibly damaging Het
Ighv5-9-1 A G 12: 113,736,545 F18S probably damaging Het
Loxhd1 A G 18: 77,383,729 T1004A probably damaging Het
Mansc4 G A 6: 147,081,544 L132F unknown Het
Mmp1a TG TGG 9: 7,465,083 probably null Het
Mtor G T 4: 148,462,940 R460L probably benign Het
Mtus1 A T 8: 41,083,380 F433Y possibly damaging Het
Myoc T C 1: 162,649,121 Y465H probably damaging Het
N4bp1 A G 8: 86,853,203 V657A probably damaging Het
Ndufv1 A T 19: 4,011,533 probably null Het
Nectin1 T C 9: 43,792,039 I198T probably benign Het
Olfr239 T A 17: 33,199,352 C101* probably null Het
Olfr44 T C 9: 39,484,881 D124G probably damaging Het
Padi2 C T 4: 140,917,596 T47I probably benign Het
Pdia4 A T 6: 47,807,122 I116N probably damaging Het
Pkdrej T A 15: 85,815,931 I1935L possibly damaging Het
Pnpla7 C A 2: 25,052,066 A1173D probably damaging Het
Ralgapa1 A T 12: 55,741,519 L593Q probably damaging Het
Scn5a A G 9: 119,543,336 S231P possibly damaging Het
Slc13a2 A G 11: 78,422,064 probably null Het
Tbxa2r G T 10: 81,334,706 *342L probably null Het
Tfrc A G 16: 32,619,167 K346R probably benign Het
Tmem52b A G 6: 129,513,003 probably benign Het
Tsc1 T C 2: 28,681,948 F844L probably damaging Het
Ttc39a A G 4: 109,426,347 N158S probably benign Het
Ulk4 C T 9: 121,263,668 E168K possibly damaging Het
Vgf T C 5: 137,032,031 L349P unknown Het
Vil1 T C 1: 74,428,136 Y681H probably damaging Het
Zfp654 A G 16: 64,783,271 *572R probably null Het
Other mutations in Spdl1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL02417:Spdl1 APN 11 34813354 missense probably benign 0.27
IGL02694:Spdl1 APN 11 34813621 missense probably benign 0.05
IGL03131:Spdl1 APN 11 34830765 missense possibly damaging 0.46
R0295:Spdl1 UTSW 11 34813343 missense possibly damaging 0.82
R0319:Spdl1 UTSW 11 34823520 missense possibly damaging 0.66
R1017:Spdl1 UTSW 11 34819290 missense possibly damaging 0.66
R1195:Spdl1 UTSW 11 34819817 missense probably damaging 0.97
R1195:Spdl1 UTSW 11 34819817 missense probably damaging 0.97
R1195:Spdl1 UTSW 11 34819817 missense probably damaging 0.97
R1296:Spdl1 UTSW 11 34813607 missense unknown
R1315:Spdl1 UTSW 11 34813407 missense unknown
R1799:Spdl1 UTSW 11 34821029 nonsense probably null
R2002:Spdl1 UTSW 11 34822646 missense probably benign
R2291:Spdl1 UTSW 11 34819309 nonsense probably null
R4771:Spdl1 UTSW 11 34813327 missense probably damaging 0.98
R5030:Spdl1 UTSW 11 34823440 missense probably benign 0.00
R5167:Spdl1 UTSW 11 34813360 missense possibly damaging 0.79
R5477:Spdl1 UTSW 11 34822210 missense possibly damaging 0.66
R6258:Spdl1 UTSW 11 34819886 missense probably damaging 0.97
R6260:Spdl1 UTSW 11 34819886 missense probably damaging 0.97
R6554:Spdl1 UTSW 11 34822570 missense possibly damaging 0.82
R6695:Spdl1 UTSW 11 34823003 splice site probably null
R6714:Spdl1 UTSW 11 34823003 splice site probably null
R6980:Spdl1 UTSW 11 34830879 start codon destroyed probably null 0.04
R7355:Spdl1 UTSW 11 34823364 missense not run
R7844:Spdl1 UTSW 11 34813343 missense possibly damaging 0.82
R8029:Spdl1 UTSW 11 34822592 missense probably benign 0.00
R8515:Spdl1 UTSW 11 34813425 missense possibly damaging 0.92
Z1176:Spdl1 UTSW 11 34822457 missense probably damaging 0.97
Predicted Primers PCR Primer
(F):5'- CTGGGAACATAGACAGAGCCAC -3'
(R):5'- TGAAGTACCTGTACTCAAAAGGAG -3'

Sequencing Primer
(F):5'- GCACAATGCAGGCGGTG -3'
(R):5'- CTCAAAAGGAGGCGCGAG -3'
Posted On2019-11-26