Incidental Mutation 'R7791:Ralgapa1'
ID 599894
Institutional Source Beutler Lab
Gene Symbol Ralgapa1
Ensembl Gene ENSMUSG00000021027
Gene Name Ral GTPase activating protein, alpha subunit 1
Synonyms Garnl1, 4930400K19Rik, Tulip1, 2310003F20Rik
MMRRC Submission 045847-MU
Accession Numbers
Essential gene? Probably essential (E-score: 0.802) question?
Stock # R7791 (G1)
Quality Score 225.009
Status Validated
Chromosome 12
Chromosomal Location 55649681-55867952 bp(-) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) A to T at 55788304 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Leucine to Glutamine at position 593 (L593Q)
Ref Sequence ENSEMBL: ENSMUSP00000082503 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000085385] [ENSMUST00000110687] [ENSMUST00000219432] [ENSMUST00000220367] [ENSMUST00000226244]
AlphaFold Q6GYP7
Predicted Effect probably damaging
Transcript: ENSMUST00000085385
AA Change: L593Q

PolyPhen 2 Score 0.970 (Sensitivity: 0.77; Specificity: 0.96)
SMART Domains Protein: ENSMUSP00000082503
Gene: ENSMUSG00000021027
AA Change: L593Q

DomainStartEndE-ValueType
low complexity region 644 651 N/A INTRINSIC
low complexity region 676 690 N/A INTRINSIC
low complexity region 692 704 N/A INTRINSIC
low complexity region 894 915 N/A INTRINSIC
low complexity region 1386 1395 N/A INTRINSIC
low complexity region 1784 1798 N/A INTRINSIC
Pfam:Rap_GAP 1824 2003 7.4e-66 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000110687
AA Change: L593Q

PolyPhen 2 Score 0.970 (Sensitivity: 0.77; Specificity: 0.96)
SMART Domains Protein: ENSMUSP00000106315
Gene: ENSMUSG00000021027
AA Change: L593Q

DomainStartEndE-ValueType
low complexity region 644 651 N/A INTRINSIC
low complexity region 676 690 N/A INTRINSIC
low complexity region 692 704 N/A INTRINSIC
low complexity region 894 915 N/A INTRINSIC
low complexity region 1386 1395 N/A INTRINSIC
low complexity region 1784 1798 N/A INTRINSIC
Pfam:Rap_GAP 1824 2001 1.9e-48 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000219432
AA Change: L593Q

PolyPhen 2 Score 0.990 (Sensitivity: 0.72; Specificity: 0.97)
Predicted Effect probably damaging
Transcript: ENSMUST00000220367
AA Change: L593Q

PolyPhen 2 Score 0.982 (Sensitivity: 0.75; Specificity: 0.96)
Predicted Effect probably damaging
Transcript: ENSMUST00000226244
AA Change: L593Q

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
Meta Mutation Damage Score 0.1969 question?
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.6%
  • 20x: 98.8%
Validation Efficiency 100% (51/51)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a major subunit of the RAL-GTPase activating protein. A similar protein in mouse binds E12, a transcriptional regulator of immunoglobulin genes. The mouse protein also functions in skeletal muscle by binding to the regulatory 14-3-3 proteins upon stimulation with insulin or muscle contraction. A pseudogene of this gene has been identified on chromosome 9. [provided by RefSeq, Oct 2016]
Allele List at MGI
Other mutations in this stock
Total: 51 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4921517D22Rik A T 13: 59,838,508 (GRCm39) M108K probably benign Het
AAdacl4fm3 A G 4: 144,430,015 (GRCm39) S325P probably damaging Het
Adamts9 A T 6: 92,849,366 (GRCm39) V1031D probably benign Het
Agap3 C T 5: 24,681,411 (GRCm39) R122C probably damaging Het
Arhgap27 A G 11: 103,230,020 (GRCm39) probably null Het
Atp1a2 T A 1: 172,103,782 (GRCm39) I950F probably benign Het
Bahcc1 T G 11: 120,159,203 (GRCm39) H143Q probably damaging Het
Bcl7b T A 5: 135,199,968 (GRCm39) D40E probably damaging Het
C9 C T 15: 6,519,359 (GRCm39) R399C possibly damaging Het
Capn13 T C 17: 73,689,883 (GRCm39) I43V possibly damaging Het
Ctcf A G 8: 106,391,571 (GRCm39) T289A possibly damaging Het
Cux2 T C 5: 122,005,162 (GRCm39) N1008S probably benign Het
Dst T A 1: 34,193,673 (GRCm39) M294K probably damaging Het
Eml4 G T 17: 83,781,135 (GRCm39) D778Y probably benign Het
Exoc3l4 A C 12: 111,389,974 (GRCm39) D183A probably damaging Het
Eya4 A T 10: 22,989,825 (GRCm39) S511T probably damaging Het
Fbrsl1 T C 5: 110,595,885 (GRCm39) H50R probably benign Het
Gemin5 G A 11: 58,015,819 (GRCm39) P1396S probably benign Het
Gnb4 A G 3: 32,644,192 (GRCm39) F151L possibly damaging Het
Gnptab A G 10: 88,276,084 (GRCm39) probably null Het
Gpbp1l1 T A 4: 116,431,617 (GRCm39) W92R probably damaging Het
Gucy1b1 A T 3: 81,942,704 (GRCm39) Y479* probably null Het
Htr3a T A 9: 48,812,875 (GRCm39) Q188L possibly damaging Het
Ighv5-9-1 A G 12: 113,700,165 (GRCm39) F18S probably damaging Het
Loxhd1 A G 18: 77,471,425 (GRCm39) T1004A probably damaging Het
Mansc4 G A 6: 146,983,042 (GRCm39) L132F unknown Het
Mmp1a TG TGG 9: 7,465,083 (GRCm38) probably null Het
Mtor G T 4: 148,547,397 (GRCm39) R460L probably benign Het
Mtus1 A T 8: 41,536,417 (GRCm39) F433Y possibly damaging Het
Myoc T C 1: 162,476,690 (GRCm39) Y465H probably damaging Het
N4bp1 A G 8: 87,579,831 (GRCm39) V657A probably damaging Het
Ndufv1 A T 19: 4,061,533 (GRCm39) probably null Het
Nectin1 T C 9: 43,703,336 (GRCm39) I198T probably benign Het
Or10h1 T A 17: 33,418,326 (GRCm39) C101* probably null Het
Or8g20 T C 9: 39,396,177 (GRCm39) D124G probably damaging Het
Padi2 C T 4: 140,644,907 (GRCm39) T47I probably benign Het
Pdia4 A T 6: 47,784,056 (GRCm39) I116N probably damaging Het
Pkdrej T A 15: 85,700,132 (GRCm39) I1935L possibly damaging Het
Pnpla7 C A 2: 24,942,078 (GRCm39) A1173D probably damaging Het
Scn5a A G 9: 119,372,402 (GRCm39) S231P possibly damaging Het
Slc13a2 A G 11: 78,312,890 (GRCm39) probably null Het
Spdl1 A G 11: 34,704,304 (GRCm39) S510P possibly damaging Het
Tbxa2r G T 10: 81,170,540 (GRCm39) *342L probably null Het
Tfrc A G 16: 32,437,985 (GRCm39) K346R probably benign Het
Tmem52b A G 6: 129,489,966 (GRCm39) probably benign Het
Tsc1 T C 2: 28,571,960 (GRCm39) F844L probably damaging Het
Ttc39a A G 4: 109,283,544 (GRCm39) N158S probably benign Het
Ulk4 C T 9: 121,092,734 (GRCm39) E168K possibly damaging Het
Vgf T C 5: 137,060,885 (GRCm39) L349P unknown Het
Vil1 T C 1: 74,467,295 (GRCm39) Y681H probably damaging Het
Zfp654 A G 16: 64,603,634 (GRCm39) *572R probably null Het
Other mutations in Ralgapa1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00089:Ralgapa1 APN 12 55,769,558 (GRCm39) missense probably damaging 0.98
IGL00494:Ralgapa1 APN 12 55,793,970 (GRCm39) missense probably damaging 1.00
IGL00731:Ralgapa1 APN 12 55,749,237 (GRCm39) missense possibly damaging 0.94
IGL00851:Ralgapa1 APN 12 55,756,360 (GRCm39) missense possibly damaging 0.93
IGL01133:Ralgapa1 APN 12 55,689,144 (GRCm39) missense probably damaging 0.99
IGL01133:Ralgapa1 APN 12 55,689,133 (GRCm39) missense probably damaging 1.00
IGL01354:Ralgapa1 APN 12 55,824,101 (GRCm39) missense possibly damaging 0.68
IGL01514:Ralgapa1 APN 12 55,766,442 (GRCm39) missense probably damaging 0.97
IGL02033:Ralgapa1 APN 12 55,689,262 (GRCm39) missense possibly damaging 0.69
IGL02064:Ralgapa1 APN 12 55,754,862 (GRCm39) missense probably damaging 1.00
IGL02556:Ralgapa1 APN 12 55,689,234 (GRCm39) missense possibly damaging 0.80
IGL02605:Ralgapa1 APN 12 55,759,450 (GRCm39) missense possibly damaging 0.90
IGL02657:Ralgapa1 APN 12 55,720,292 (GRCm39) missense probably damaging 1.00
IGL02676:Ralgapa1 APN 12 55,723,202 (GRCm39) missense probably damaging 1.00
IGL02894:Ralgapa1 APN 12 55,763,854 (GRCm39) missense possibly damaging 0.79
IGL02944:Ralgapa1 APN 12 55,804,736 (GRCm39) missense probably benign 0.01
Anhydrous UTSW 12 55,842,563 (GRCm39) critical splice acceptor site probably null
Aqueous UTSW 12 55,745,639 (GRCm39) missense probably damaging 1.00
bantam UTSW 12 55,769,558 (GRCm39) critical splice donor site probably null
Deliquescent UTSW 12 55,829,685 (GRCm39) splice site probably benign
wickedwarlock UTSW 12 55,824,077 (GRCm39) missense probably null 0.99
F5770:Ralgapa1 UTSW 12 55,842,438 (GRCm39) splice site probably benign
IGL03046:Ralgapa1 UTSW 12 55,741,942 (GRCm39) missense probably damaging 1.00
R0011:Ralgapa1 UTSW 12 55,833,048 (GRCm39) missense probably damaging 0.99
R0096:Ralgapa1 UTSW 12 55,786,290 (GRCm39) missense probably damaging 1.00
R0277:Ralgapa1 UTSW 12 55,724,023 (GRCm39) missense probably damaging 0.99
R0323:Ralgapa1 UTSW 12 55,724,023 (GRCm39) missense probably damaging 0.99
R0333:Ralgapa1 UTSW 12 55,829,685 (GRCm39) splice site probably benign
R0361:Ralgapa1 UTSW 12 55,723,354 (GRCm39) missense possibly damaging 0.93
R0385:Ralgapa1 UTSW 12 55,723,823 (GRCm39) missense probably damaging 1.00
R0386:Ralgapa1 UTSW 12 55,754,852 (GRCm39) missense probably benign 0.03
R0498:Ralgapa1 UTSW 12 55,736,576 (GRCm39) missense possibly damaging 0.66
R0552:Ralgapa1 UTSW 12 55,723,550 (GRCm39) missense probably benign 0.27
R0564:Ralgapa1 UTSW 12 55,829,670 (GRCm39) missense possibly damaging 0.84
R0611:Ralgapa1 UTSW 12 55,842,483 (GRCm39) missense probably damaging 0.99
R0730:Ralgapa1 UTSW 12 55,712,448 (GRCm39) missense probably damaging 1.00
R0741:Ralgapa1 UTSW 12 55,723,366 (GRCm39) missense probably damaging 0.99
R0815:Ralgapa1 UTSW 12 55,829,562 (GRCm39) splice site probably benign
R0815:Ralgapa1 UTSW 12 55,809,466 (GRCm39) nonsense probably null
R0863:Ralgapa1 UTSW 12 55,829,562 (GRCm39) splice site probably benign
R0863:Ralgapa1 UTSW 12 55,809,466 (GRCm39) nonsense probably null
R1068:Ralgapa1 UTSW 12 55,837,095 (GRCm39) critical splice donor site probably null
R1147:Ralgapa1 UTSW 12 55,749,265 (GRCm39) missense probably damaging 1.00
R1147:Ralgapa1 UTSW 12 55,749,265 (GRCm39) missense probably damaging 1.00
R1256:Ralgapa1 UTSW 12 55,809,446 (GRCm39) missense possibly damaging 0.94
R1343:Ralgapa1 UTSW 12 55,754,763 (GRCm39) missense probably damaging 1.00
R1378:Ralgapa1 UTSW 12 55,723,711 (GRCm39) missense probably damaging 1.00
R1474:Ralgapa1 UTSW 12 55,788,265 (GRCm39) missense probably benign 0.09
R1494:Ralgapa1 UTSW 12 55,731,309 (GRCm39) missense probably damaging 0.99
R1593:Ralgapa1 UTSW 12 55,817,488 (GRCm39) missense probably damaging 1.00
R1607:Ralgapa1 UTSW 12 55,788,321 (GRCm39) missense probably damaging 1.00
R1681:Ralgapa1 UTSW 12 55,809,388 (GRCm39) missense probably benign 0.35
R1689:Ralgapa1 UTSW 12 55,723,552 (GRCm39) missense possibly damaging 0.79
R1714:Ralgapa1 UTSW 12 55,689,174 (GRCm39) missense probably damaging 1.00
R1832:Ralgapa1 UTSW 12 55,804,752 (GRCm39) missense probably benign 0.03
R1870:Ralgapa1 UTSW 12 55,723,817 (GRCm39) missense possibly damaging 0.66
R2040:Ralgapa1 UTSW 12 55,833,107 (GRCm39) missense probably damaging 1.00
R2043:Ralgapa1 UTSW 12 55,723,811 (GRCm39) missense probably damaging 0.99
R2046:Ralgapa1 UTSW 12 55,741,945 (GRCm39) missense probably damaging 1.00
R2109:Ralgapa1 UTSW 12 55,822,973 (GRCm39) missense possibly damaging 0.90
R2114:Ralgapa1 UTSW 12 55,833,134 (GRCm39) critical splice acceptor site probably null
R2115:Ralgapa1 UTSW 12 55,833,134 (GRCm39) critical splice acceptor site probably null
R2202:Ralgapa1 UTSW 12 55,659,585 (GRCm39) splice site probably null
R2203:Ralgapa1 UTSW 12 55,659,585 (GRCm39) splice site probably null
R2233:Ralgapa1 UTSW 12 55,763,856 (GRCm39) missense probably benign 0.13
R2235:Ralgapa1 UTSW 12 55,763,856 (GRCm39) missense probably benign 0.13
R2341:Ralgapa1 UTSW 12 55,723,909 (GRCm39) missense possibly damaging 0.66
R2507:Ralgapa1 UTSW 12 55,764,986 (GRCm39) missense probably damaging 1.00
R2508:Ralgapa1 UTSW 12 55,764,986 (GRCm39) missense probably damaging 1.00
R2972:Ralgapa1 UTSW 12 55,867,540 (GRCm39) missense possibly damaging 0.61
R3160:Ralgapa1 UTSW 12 55,756,371 (GRCm39) missense probably damaging 1.00
R3162:Ralgapa1 UTSW 12 55,756,371 (GRCm39) missense probably damaging 1.00
R3401:Ralgapa1 UTSW 12 55,705,922 (GRCm39) missense possibly damaging 0.66
R3416:Ralgapa1 UTSW 12 55,817,398 (GRCm39) splice site probably benign
R3499:Ralgapa1 UTSW 12 55,741,928 (GRCm39) splice site probably benign
R3799:Ralgapa1 UTSW 12 55,705,915 (GRCm39) missense probably damaging 1.00
R3948:Ralgapa1 UTSW 12 55,745,552 (GRCm39) missense probably damaging 1.00
R4039:Ralgapa1 UTSW 12 55,842,486 (GRCm39) missense probably damaging 0.99
R4120:Ralgapa1 UTSW 12 55,687,429 (GRCm39) missense probably damaging 1.00
R4165:Ralgapa1 UTSW 12 55,687,429 (GRCm39) missense probably damaging 1.00
R4166:Ralgapa1 UTSW 12 55,687,429 (GRCm39) missense probably damaging 1.00
R4212:Ralgapa1 UTSW 12 55,786,115 (GRCm39) critical splice donor site probably null
R4232:Ralgapa1 UTSW 12 55,687,429 (GRCm39) missense probably damaging 1.00
R4233:Ralgapa1 UTSW 12 55,687,429 (GRCm39) missense probably damaging 1.00
R4234:Ralgapa1 UTSW 12 55,687,429 (GRCm39) missense probably damaging 1.00
R4235:Ralgapa1 UTSW 12 55,687,429 (GRCm39) missense probably damaging 1.00
R4399:Ralgapa1 UTSW 12 55,842,563 (GRCm39) critical splice acceptor site probably null
R4698:Ralgapa1 UTSW 12 55,724,061 (GRCm39) splice site probably null
R4715:Ralgapa1 UTSW 12 55,740,243 (GRCm39) missense probably damaging 1.00
R4755:Ralgapa1 UTSW 12 55,759,533 (GRCm39) missense probably damaging 1.00
R4810:Ralgapa1 UTSW 12 55,841,778 (GRCm39) critical splice donor site probably null
R4827:Ralgapa1 UTSW 12 55,723,222 (GRCm39) missense probably damaging 1.00
R4849:Ralgapa1 UTSW 12 55,745,588 (GRCm39) missense probably damaging 0.99
R4934:Ralgapa1 UTSW 12 55,809,359 (GRCm39) missense possibly damaging 0.94
R5006:Ralgapa1 UTSW 12 55,764,899 (GRCm39) missense probably benign 0.02
R5114:Ralgapa1 UTSW 12 55,659,508 (GRCm39) missense possibly damaging 0.84
R5140:Ralgapa1 UTSW 12 55,712,459 (GRCm39) missense probably damaging 1.00
R5140:Ralgapa1 UTSW 12 55,822,937 (GRCm39) missense probably damaging 1.00
R5168:Ralgapa1 UTSW 12 55,804,817 (GRCm39) missense probably benign 0.05
R5407:Ralgapa1 UTSW 12 55,723,582 (GRCm39) missense possibly damaging 0.93
R5441:Ralgapa1 UTSW 12 55,766,408 (GRCm39) missense probably damaging 1.00
R5473:Ralgapa1 UTSW 12 55,723,495 (GRCm39) missense probably benign 0.41
R5624:Ralgapa1 UTSW 12 55,659,523 (GRCm39) missense probably damaging 1.00
R5766:Ralgapa1 UTSW 12 55,867,551 (GRCm39) start codon destroyed probably null 0.99
R5826:Ralgapa1 UTSW 12 55,723,898 (GRCm39) missense probably damaging 1.00
R5950:Ralgapa1 UTSW 12 55,785,050 (GRCm39) missense possibly damaging 0.58
R5980:Ralgapa1 UTSW 12 55,817,401 (GRCm39) splice site probably null
R6019:Ralgapa1 UTSW 12 55,730,827 (GRCm39) missense possibly damaging 0.92
R6065:Ralgapa1 UTSW 12 55,804,709 (GRCm39) critical splice donor site probably null
R6326:Ralgapa1 UTSW 12 55,793,931 (GRCm39) missense probably damaging 1.00
R6355:Ralgapa1 UTSW 12 55,745,639 (GRCm39) missense probably damaging 1.00
R6408:Ralgapa1 UTSW 12 55,730,695 (GRCm39) nonsense probably null
R6448:Ralgapa1 UTSW 12 55,766,446 (GRCm39) missense probably benign 0.14
R6453:Ralgapa1 UTSW 12 55,785,104 (GRCm39) missense probably damaging 1.00
R6590:Ralgapa1 UTSW 12 55,769,558 (GRCm39) critical splice donor site probably null
R6690:Ralgapa1 UTSW 12 55,769,558 (GRCm39) critical splice donor site probably null
R6738:Ralgapa1 UTSW 12 55,809,512 (GRCm39) missense probably damaging 1.00
R6836:Ralgapa1 UTSW 12 55,651,058 (GRCm39) splice site probably null
R6936:Ralgapa1 UTSW 12 55,832,997 (GRCm39) missense probably damaging 0.99
R6945:Ralgapa1 UTSW 12 55,822,976 (GRCm39) missense possibly damaging 0.64
R7028:Ralgapa1 UTSW 12 55,804,844 (GRCm39) missense probably damaging 1.00
R7075:Ralgapa1 UTSW 12 55,867,508 (GRCm39) missense possibly damaging 0.66
R7076:Ralgapa1 UTSW 12 55,768,361 (GRCm39) missense possibly damaging 0.82
R7098:Ralgapa1 UTSW 12 55,837,095 (GRCm39) critical splice donor site probably null
R7231:Ralgapa1 UTSW 12 55,650,976 (GRCm39) missense probably damaging 1.00
R7254:Ralgapa1 UTSW 12 55,741,978 (GRCm39) missense probably damaging 1.00
R7326:Ralgapa1 UTSW 12 55,755,789 (GRCm39) missense probably damaging 1.00
R7485:Ralgapa1 UTSW 12 55,759,457 (GRCm39) missense probably damaging 1.00
R7580:Ralgapa1 UTSW 12 55,765,013 (GRCm39) missense probably benign 0.00
R7677:Ralgapa1 UTSW 12 55,705,928 (GRCm39) missense probably damaging 0.96
R7702:Ralgapa1 UTSW 12 55,756,341 (GRCm39) missense probably damaging 1.00
R7702:Ralgapa1 UTSW 12 55,756,340 (GRCm39) missense probably damaging 1.00
R7707:Ralgapa1 UTSW 12 55,824,077 (GRCm39) missense probably null 0.99
R7723:Ralgapa1 UTSW 12 55,788,298 (GRCm39) missense probably benign
R7763:Ralgapa1 UTSW 12 55,804,740 (GRCm39) missense probably benign 0.28
R7812:Ralgapa1 UTSW 12 55,766,413 (GRCm39) missense possibly damaging 0.67
R7868:Ralgapa1 UTSW 12 55,659,423 (GRCm39) missense probably benign 0.00
R7895:Ralgapa1 UTSW 12 55,793,934 (GRCm39) missense probably benign 0.44
R7896:Ralgapa1 UTSW 12 55,744,663 (GRCm39) missense probably benign 0.01
R8004:Ralgapa1 UTSW 12 55,749,242 (GRCm39) missense probably damaging 0.99
R8094:Ralgapa1 UTSW 12 55,829,631 (GRCm39) missense probably damaging 0.99
R8213:Ralgapa1 UTSW 12 55,769,699 (GRCm39) missense probably damaging 0.99
R8307:Ralgapa1 UTSW 12 55,788,308 (GRCm39) missense probably damaging 0.99
R8423:Ralgapa1 UTSW 12 55,705,847 (GRCm39) missense probably damaging 0.99
R8462:Ralgapa1 UTSW 12 55,723,303 (GRCm39) missense possibly damaging 0.90
R8469:Ralgapa1 UTSW 12 55,786,198 (GRCm39) missense probably damaging 1.00
R8675:Ralgapa1 UTSW 12 55,785,002 (GRCm39) missense possibly damaging 0.93
R8802:Ralgapa1 UTSW 12 55,785,101 (GRCm39) missense probably damaging 0.99
R8937:Ralgapa1 UTSW 12 55,749,345 (GRCm39) missense probably damaging 0.96
R8953:Ralgapa1 UTSW 12 55,867,546 (GRCm39) missense probably damaging 0.99
R8974:Ralgapa1 UTSW 12 55,723,791 (GRCm39) missense probably benign
R9011:Ralgapa1 UTSW 12 55,652,314 (GRCm39) intron probably benign
R9089:Ralgapa1 UTSW 12 55,723,351 (GRCm39) missense probably damaging 0.97
R9124:Ralgapa1 UTSW 12 55,781,881 (GRCm39) missense probably damaging 1.00
R9254:Ralgapa1 UTSW 12 55,769,583 (GRCm39) missense probably damaging 1.00
R9320:Ralgapa1 UTSW 12 55,755,843 (GRCm39) missense possibly damaging 0.59
R9379:Ralgapa1 UTSW 12 55,769,583 (GRCm39) missense probably damaging 1.00
R9446:Ralgapa1 UTSW 12 55,754,808 (GRCm39) missense probably damaging 0.97
R9684:Ralgapa1 UTSW 12 55,659,485 (GRCm39) missense possibly damaging 0.63
Z1176:Ralgapa1 UTSW 12 55,755,865 (GRCm39) missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- CCTTTAACATGAACTGGCTTGTAAC -3'
(R):5'- GGTATTGATTGTGCTTAGAAACTTCAG -3'

Sequencing Primer
(F):5'- CATGAACTGGCTTGTAACTTAAAGC -3'
(R):5'- CGAGTTATCCCAACAATAATG -3'
Posted On 2019-11-26