Mutagenetix > Incidental Mutations

Incidental Mutation 'R7791:Loxhd1'

599905

Institutional Source

Beutler Lab

Gene Symbol

Loxhd1

Ensembl Gene

ENSMUSG00000032818

Gene Name

lipoxygenase homology domains 1

Synonyms

sba, 1700096C21Rik

Accession Numbers

Is this an essential gene?

Probably non essential (E-score: 0.207) question?

Stock #

R7791 (G1)

Quality Score

225.009

Status

Not validated

Chromosome

Chromosomal Location

77281958-77442341 bp(+) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

A to G at 77383729 bp

Zygosity

Heterozygous

Amino Acid Change

Threonine to Alanine at position 1004 (T1004A)

Ref Sequence

ENSEMBL: ENSMUSP00000094294 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000035501] [ENSMUST00000096547] [ENSMUST00000123410] [ENSMUST00000148341]

Predicted Effect

probably benign
Transcript: ENSMUST00000035501

SMART Domains

Protein: ENSMUSP00000045450
Gene: ENSMUSG00000032818

Domain	Start	End	E-Value	Type
Pfam:PLAT	1	53	3.2e-7	PFAM
LH2	63	176	1.1e-4	SMART
LH2	192	306	4.02e-4	SMART
LH2	320	442	3.79e-6	SMART
LH2	451	567	5.92e-6	SMART
LH2	581	696	7.67e-3	SMART
LH2	793	913	1.47e-11	SMART
low complexity region	922	931	N/A	INTRINSIC
SCOP:d1lox_2	949	974	1e-4	SMART

Predicted Effect

probably damaging
Transcript: ENSMUST00000096547
AA Change: T1004A

PolyPhen 2 Score 0.996 (Sensitivity: 0.55; Specificity: 0.98)

SMART Domains

Protein: ENSMUSP00000094294
Gene: ENSMUSG00000032818
AA Change: T1004A

Domain	Start	End	E-Value	Type
LH2	43	158	5.64e-5	SMART
LH2	172	290	1.64e-9	SMART
LH2	296	409	1.1e-4	SMART
LH2	425	539	4.02e-4	SMART
LH2	553	675	3.79e-6	SMART
LH2	684	800	5.92e-6	SMART
LH2	814	936	6.91e-8	SMART
low complexity region	945	954	N/A	INTRINSIC
LH2	970	1086	4.81e-7	SMART
LH2	1101	1228	5.73e-3	SMART
LH2	1255	1375	8.82e-5	SMART
Pfam:PLAT	1424	1540	5.4e-10	PFAM
LH2	1553	1666	6.41e-3	SMART
LH2	1680	1799	6.76e-6	SMART
Pfam:PLAT	1813	1929	3.8e-9	PFAM
LH2	1949	2067	7.23e-11	SMART

Predicted Effect

probably benign
Transcript: ENSMUST00000123410
AA Change: T138A

PolyPhen 2 Score 0.001 (Sensitivity: 0.99; Specificity: 0.15)

SMART Domains

Protein: ENSMUSP00000120991
Gene: ENSMUSG00000032818
AA Change: T138A

Domain	Start	End	E-Value	Type
Pfam:PLAT	1	67	4.4e-15	PFAM
low complexity region	79	88	N/A	INTRINSIC
LH2	104	220	4.81e-7	SMART
LH2	235	362	5.73e-3	SMART
LH2	389	509	8.82e-5	SMART
Pfam:PLAT	558	674	9.9e-12	PFAM
LH2	687	800	6.41e-3	SMART
LH2	814	933	6.76e-6	SMART
Pfam:PLAT	947	1065	8.8e-9	PFAM
Pfam:PLAT	1085	1174	4.2e-11	PFAM

Predicted Effect

probably benign
Transcript: ENSMUST00000148341
AA Change: T895A

PolyPhen 2 Score 0.108 (Sensitivity: 0.93; Specificity: 0.86)

SMART Domains

Protein: ENSMUSP00000114988
Gene: ENSMUSG00000032818
AA Change: T895A

Domain	Start	End	E-Value	Type
Pfam:PLAT	1	91	1.7e-11	PFAM
LH2	106	220	4.02e-4	SMART
LH2	234	356	3.79e-6	SMART
LH2	365	481	5.92e-6	SMART
LH2	495	610	7.67e-3	SMART
LH2	707	827	1.47e-11	SMART
low complexity region	836	845	N/A	INTRINSIC
LH2	861	977	4.81e-7	SMART
LH2	992	1119	5.73e-3	SMART
LH2	1146	1266	8.82e-5	SMART
Pfam:PLAT	1384	1469	8.9e-14	PFAM

Coding Region Coverage

1x: 100.0%
3x: 99.9%
10x: 99.6%
20x: 98.8%

Validation Efficiency

MGI Phenotype

PHENOTYPE: Mice honozygous for an ENU-induced mutation exhibit hearing loss associated with hair cell and spiral ganglion degeneration. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 50 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
4921517D22Rik	A	T	13: 59,690,694	M108K	probably benign	Het
Adamts9	A	T	6: 92,872,385	V1031D	probably benign	Het
Agap3	C	T	5: 24,476,413	R122C	probably damaging	Het
Arhgap27	A	G	11: 103,339,194		probably null	Het
Atp1a2	T	A	1: 172,276,215	I950F	probably benign	Het
Bahcc1	T	G	11: 120,268,377	H143Q	probably damaging	Het
Bcl7b	T	A	5: 135,171,114	D40E	probably damaging	Het
C9	C	T	15: 6,489,878	R399C	possibly damaging	Het
Capn13	T	C	17: 73,382,888	I43V	possibly damaging	Het
Ctcf	A	G	8: 105,664,939	T289A	possibly damaging	Het
Cux2	T	C	5: 121,867,099	N1008S	probably benign	Het
Dst	T	A	1: 34,154,592	M294K	probably damaging	Het
Eml4	G	T	17: 83,473,706	D778Y	probably benign	Het
Exoc3l4	A	C	12: 111,423,540	D183A	probably damaging	Het
Eya4	A	T	10: 23,113,926	S511T	probably damaging	Het
Fbrsl1	T	C	5: 110,448,019	H50R	probably benign	Het
Gemin5	G	A	11: 58,124,993	P1396S	probably benign	Het
Gm13178	A	G	4: 144,703,445	S325P	probably damaging	Het
Gnb4	A	G	3: 32,590,043	F151L	possibly damaging	Het
Gnptab	A	G	10: 88,440,222		probably null	Het
Gpbp1l1	T	A	4: 116,574,420	W92R	probably damaging	Het
Gucy1b1	A	T	3: 82,035,397	Y479*	probably null	Het
Htr3a	T	A	9: 48,901,575	Q188L	possibly damaging	Het
Ighv5-9-1	A	G	12: 113,736,545	F18S	probably damaging	Het
Mansc4	G	A	6: 147,081,544	L132F	unknown	Het
Mmp1a	TG	TGG	9: 7,465,083		probably null	Het
Mtor	G	T	4: 148,462,940	R460L	probably benign	Het
Mtus1	A	T	8: 41,083,380	F433Y	possibly damaging	Het
Myoc	T	C	1: 162,649,121	Y465H	probably damaging	Het
N4bp1	A	G	8: 86,853,203	V657A	probably damaging	Het
Nectin1	T	C	9: 43,792,039	I198T	probably benign	Het
Olfr239	T	A	17: 33,199,352	C101*	probably null	Het
Olfr44	T	C	9: 39,484,881	D124G	probably damaging	Het
Padi2	C	T	4: 140,917,596	T47I	probably benign	Het
Pdia4	A	T	6: 47,807,122	I116N	probably damaging	Het
Pkdrej	T	A	15: 85,815,931	I1935L	possibly damaging	Het
Pnpla7	C	A	2: 25,052,066	A1173D	probably damaging	Het
Ralgapa1	A	T	12: 55,741,519	L593Q	probably damaging	Het
Scn5a	A	G	9: 119,543,336	S231P	possibly damaging	Het
Slc13a2	A	G	11: 78,422,064		probably null	Het
Spdl1	A	G	11: 34,813,477	S510P	possibly damaging	Het
Tbxa2r	G	T	10: 81,334,706	*342L	probably null	Het
Tfrc	A	G	16: 32,619,167	K346R	probably benign	Het
Tmem52b	A	G	6: 129,513,003		probably benign	Het
Tsc1	T	C	2: 28,681,948	F844L	probably damaging	Het
Ttc39a	A	G	4: 109,426,347	N158S	probably benign	Het
Ulk4	C	T	9: 121,263,668	E168K	possibly damaging	Het
Vgf	T	C	5: 137,032,031	L349P	unknown	Het
Vil1	T	C	1: 74,428,136	Y681H	probably damaging	Het
Zfp654	A	G	16: 64,783,271	*572R	probably null	Het

Other mutations in Loxhd1

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00330:Loxhd1	APN	18	77395450	missense	probably damaging	0.99
IGL00490:Loxhd1	APN	18	77431074	missense	possibly damaging	0.94
IGL00507:Loxhd1	APN	18	77332567	missense	probably benign	0.03
IGL00546:Loxhd1	APN	18	77405976	missense	probably damaging	0.97
IGL01369:Loxhd1	APN	18	77329201	missense	possibly damaging	0.85
IGL01767:Loxhd1	APN	18	77286424	missense	possibly damaging	0.71
IGL02245:Loxhd1	APN	18	77340101	missense	possibly damaging	0.71
IGL02388:Loxhd1	APN	18	77369137	missense	probably benign	0.18
IGL02410:Loxhd1	APN	18	77402952	missense	probably benign	0.02
IGL02593:Loxhd1	APN	18	77410539	missense	possibly damaging	0.91
IGL02632:Loxhd1	APN	18	77405932	missense	probably damaging	0.99
IGL02692:Loxhd1	APN	18	77356913	missense	probably damaging	0.99
IGL02796:Loxhd1	APN	18	77369115	splice site	probably benign
IGL03032:Loxhd1	APN	18	77286473	missense	possibly damaging	0.93
IGL03074:Loxhd1	APN	18	77441784	missense	possibly damaging	0.75
IGL03094:Loxhd1	APN	18	77431113	missense	possibly damaging	0.88
IGL03118:Loxhd1	APN	18	77380464	missense	probably damaging	1.00
IGL03232:Loxhd1	APN	18	77408750	missense	probably damaging	1.00
IGL03377:Loxhd1	APN	18	77441673	missense	possibly damaging	0.91
H8562:Loxhd1	UTSW	18	77341931	missense	possibly damaging	0.93
PIT4494001:Loxhd1	UTSW	18	77441768	missense	probably damaging	0.99
R0003:Loxhd1	UTSW	18	77339500	missense	probably damaging	0.98
R0003:Loxhd1	UTSW	18	77339500	missense	probably damaging	0.98
R0048:Loxhd1	UTSW	18	77408778	missense	probably damaging	0.99
R0049:Loxhd1	UTSW	18	77380560	splice site	probably benign
R0049:Loxhd1	UTSW	18	77380560	splice site	probably benign
R0206:Loxhd1	UTSW	18	77404866	missense	possibly damaging	0.90
R0206:Loxhd1	UTSW	18	77404866	missense	possibly damaging	0.90
R0208:Loxhd1	UTSW	18	77404866	missense	possibly damaging	0.90
R0323:Loxhd1	UTSW	18	77369137	missense	probably benign	0.18
R0332:Loxhd1	UTSW	18	77383830	synonymous	probably null
R0367:Loxhd1	UTSW	18	77425757	splice site	probably benign
R0709:Loxhd1	UTSW	18	77404969	missense	probably benign	0.23
R0783:Loxhd1	UTSW	18	77429984	missense	possibly damaging	0.58
R1132:Loxhd1	UTSW	18	77429943	missense	possibly damaging	0.71
R1232:Loxhd1	UTSW	18	77406003	critical splice donor site	probably null
R1331:Loxhd1	UTSW	18	77402936	missense	possibly damaging	0.86
R1465:Loxhd1	UTSW	18	77380573	intron	probably null
R1465:Loxhd1	UTSW	18	77380573	intron	probably null
R1501:Loxhd1	UTSW	18	77356832	missense	probably damaging	1.00
R1640:Loxhd1	UTSW	18	77402563	missense	probably damaging	1.00
R1656:Loxhd1	UTSW	18	77321668	missense	possibly damaging	0.71
R1671:Loxhd1	UTSW	18	77404802	missense	probably damaging	1.00
R1725:Loxhd1	UTSW	18	77293241	missense	probably benign	0.32
R1735:Loxhd1	UTSW	18	77404889	missense	probably damaging	0.98
R1796:Loxhd1	UTSW	18	77405907	missense	probably damaging	0.96
R1796:Loxhd1	UTSW	18	77425639	missense	possibly damaging	0.88
R1800:Loxhd1	UTSW	18	77402502	missense	probably damaging	1.00
R1848:Loxhd1	UTSW	18	77281971	missense	possibly damaging	0.53
R1912:Loxhd1	UTSW	18	77340137	missense	probably benign	0.32
R1945:Loxhd1	UTSW	18	77404808	missense	probably damaging	1.00
R1978:Loxhd1	UTSW	18	77321642	missense	possibly damaging	0.86
R1997:Loxhd1	UTSW	18	77295769	missense	probably damaging	0.98
R2086:Loxhd1	UTSW	18	77384946	missense	probably damaging	1.00
R2153:Loxhd1	UTSW	18	77356166	missense	possibly damaging	0.72
R3124:Loxhd1	UTSW	18	77431078	missense	probably damaging	0.97
R3896:Loxhd1	UTSW	18	77382023	missense	possibly damaging	0.65
R3907:Loxhd1	UTSW	18	77408768	missense	possibly damaging	0.60
R3980:Loxhd1	UTSW	18	77414159	missense	probably damaging	1.00
R4165:Loxhd1	UTSW	18	77372329	missense	probably damaging	0.99
R4166:Loxhd1	UTSW	18	77372329	missense	probably damaging	0.99
R4176:Loxhd1	UTSW	18	77331059	missense	possibly damaging	0.53
R4345:Loxhd1	UTSW	18	77399001	missense	possibly damaging	0.89
R4354:Loxhd1	UTSW	18	77395427	missense	probably damaging	1.00
R4385:Loxhd1	UTSW	18	77372911	missense	probably damaging	0.99
R4402:Loxhd1	UTSW	18	77441760	missense	possibly damaging	0.94
R4404:Loxhd1	UTSW	18	77431132	missense	probably damaging	1.00
R4456:Loxhd1	UTSW	18	77399089	missense	probably damaging	1.00
R4525:Loxhd1	UTSW	18	77356912	missense	probably damaging	0.98
R4605:Loxhd1	UTSW	18	77405946	missense	probably benign	0.00
R4661:Loxhd1	UTSW	18	77402885	missense	possibly damaging	0.79
R4698:Loxhd1	UTSW	18	77372291	missense	possibly damaging	0.82
R4725:Loxhd1	UTSW	18	77395457	missense	probably damaging	1.00
R4820:Loxhd1	UTSW	18	77384967	missense	probably damaging	1.00
R5163:Loxhd1	UTSW	18	77361736	missense	possibly damaging	0.92
R5288:Loxhd1	UTSW	18	77363612	missense	probably damaging	1.00
R5328:Loxhd1	UTSW	18	77410572	missense	probably damaging	1.00
R5329:Loxhd1	UTSW	18	77332682	missense	probably damaging	0.98
R5347:Loxhd1	UTSW	18	77366541	missense	probably damaging	1.00
R5589:Loxhd1	UTSW	18	77342055	missense	possibly damaging	0.86
R5616:Loxhd1	UTSW	18	77404951	missense	probably damaging	1.00
R5703:Loxhd1	UTSW	18	77356877	missense	probably damaging	1.00
R5837:Loxhd1	UTSW	18	77286409	missense	possibly damaging	0.71
R5888:Loxhd1	UTSW	18	77402515	missense	probably damaging	0.99
R6021:Loxhd1	UTSW	18	77412250	missense	probably damaging	1.00
R6032:Loxhd1	UTSW	18	77381558	missense	probably damaging	1.00
R6032:Loxhd1	UTSW	18	77381558	missense	probably damaging	1.00
R6153:Loxhd1	UTSW	18	77295758	missense	possibly damaging	0.71
R6174:Loxhd1	UTSW	18	77412178	missense	probably damaging	1.00
R6265:Loxhd1	UTSW	18	77361730	missense	probably damaging	0.99
R6377:Loxhd1	UTSW	18	77380432	missense	probably damaging	1.00
R6530:Loxhd1	UTSW	18	77412151	missense	probably benign	0.30
R6555:Loxhd1	UTSW	18	77293269	missense	possibly damaging	0.51
R6782:Loxhd1	UTSW	18	77431177	missense	probably damaging	0.99
R6834:Loxhd1	UTSW	18	77441526	missense	probably damaging	1.00
R7000:Loxhd1	UTSW	18	77372433	critical splice donor site	probably null
R7112:Loxhd1	UTSW	18	77388514	missense	probably damaging	1.00
R7203:Loxhd1	UTSW	18	77414196	missense	probably damaging	0.97
R7206:Loxhd1	UTSW	18	77441817	missense	probably damaging	0.97
R7260:Loxhd1	UTSW	18	77332642	missense	possibly damaging	0.93
R7432:Loxhd1	UTSW	18	77295851	missense	possibly damaging	0.51
R7475:Loxhd1	UTSW	18	77412305	missense	possibly damaging	0.83
R7555:Loxhd1	UTSW	18	77395365	missense	probably damaging	0.99
R7590:Loxhd1	UTSW	18	77321634	missense	possibly damaging	0.84
R7612:Loxhd1	UTSW	18	77429975	missense	possibly damaging	0.95
R7626:Loxhd1	UTSW	18	77431186	missense	possibly damaging	0.75
R7768:Loxhd1	UTSW	18	77384941	missense	probably damaging	0.99
R7829:Loxhd1	UTSW	18	77408787	missense	probably damaging	0.99
R7884:Loxhd1	UTSW	18	77431213	missense	probably damaging	0.98
R7967:Loxhd1	UTSW	18	77431213	missense	probably damaging	0.98
X0020:Loxhd1	UTSW	18	77339562	nonsense	probably null
X0024:Loxhd1	UTSW	18	77395403	missense	probably damaging	1.00
X0062:Loxhd1	UTSW	18	77441516	missense	probably damaging	1.00

Predicted Primers

PCR Primer
(F):5'- TGCAAGCATACGTGAGAGAGTTT -3'
(R):5'- GCACAAGTGATTGGGCCA -3'

Sequencing Primer
(F):5'- TACGTGCATATACACCACATACATG -3'
(R):5'- GCCAAGGGCTCTGTAGC -3'

Posted On

2019-11-26