Incidental Mutation 'R7792:Clca3a1'
ID 599924
Institutional Source Beutler Lab
Gene Symbol Clca3a1
Ensembl Gene ENSMUSG00000056025
Gene Name chloride channel accessory 3A1
Synonyms Clca1
MMRRC Submission 045848-MU
Accession Numbers
Essential gene? Probably non essential (E-score: 0.065) question?
Stock # R7792 (G1)
Quality Score 225.009
Status Validated
Chromosome 3
Chromosomal Location 144435438-144466738 bp(-) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) T to A at 144455492 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Isoleucine to Phenylalanine at position 434 (I434F)
Ref Sequence ENSEMBL: ENSMUSP00000054526 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000029932] [ENSMUST00000059091]
AlphaFold Q9QX15
Predicted Effect possibly damaging
Transcript: ENSMUST00000029932
AA Change: I434F

PolyPhen 2 Score 0.895 (Sensitivity: 0.82; Specificity: 0.94)
SMART Domains Protein: ENSMUSP00000029932
Gene: ENSMUSG00000056025
AA Change: I434F

DomainStartEndE-ValueType
Pfam:CLCA_N 1 262 5.8e-144 PFAM
VWA 306 473 1.81e-20 SMART
Predicted Effect possibly damaging
Transcript: ENSMUST00000059091
AA Change: I434F

PolyPhen 2 Score 0.948 (Sensitivity: 0.79; Specificity: 0.95)
SMART Domains Protein: ENSMUSP00000054526
Gene: ENSMUSG00000056025
AA Change: I434F

DomainStartEndE-ValueType
signal peptide 1 21 N/A INTRINSIC
VWA 306 478 1.44e-23 SMART
Blast:FN3 758 857 2e-44 BLAST
Meta Mutation Damage Score 0.1795 question?
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.7%
  • 20x: 98.9%
Validation Efficiency 100% (97/97)
Allele List at MGI
Other mutations in this stock
Total: 99 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Aars1 G T 8: 111,769,896 (GRCm39) V332F possibly damaging Het
Abhd15 T A 11: 77,409,560 (GRCm39) S425T probably benign Het
Acads A T 5: 115,250,840 (GRCm39) F152L probably damaging Het
Acp3 T A 9: 104,204,165 (GRCm39) H43L probably damaging Het
Adora2a A G 10: 75,169,480 (GRCm39) S315G probably benign Het
Agxt2 A T 15: 10,381,472 (GRCm39) D242V probably damaging Het
Alx4 A G 2: 93,473,056 (GRCm39) D18G probably damaging Het
Ankrd11 A G 8: 123,610,970 (GRCm39) S2639P probably damaging Het
Arhgap35 A T 7: 16,295,453 (GRCm39) V1204D possibly damaging Het
Arid2 A G 15: 96,267,256 (GRCm39) T579A probably benign Het
B4galt1 C T 4: 40,809,373 (GRCm39) G332S probably benign Het
B4galt4 C A 16: 38,578,172 (GRCm39) Y206* probably null Het
Bcl2l14 A T 6: 134,409,277 (GRCm39) T284S possibly damaging Het
Bop1 C T 15: 76,338,548 (GRCm39) V465M probably damaging Het
Cacna1b A T 2: 24,567,977 (GRCm39) L1037H probably damaging Het
Cadm2 G A 16: 66,568,523 (GRCm39) T254M probably benign Het
Ccdc180 T C 4: 45,890,389 (GRCm39) probably null Het
Ccdc7a A T 8: 129,618,918 (GRCm39) D875E possibly damaging Het
Cenpu A G 8: 47,015,502 (GRCm39) D139G possibly damaging Het
Cep57l1 A T 10: 41,598,936 (GRCm39) C292* probably null Het
Cep89 G A 7: 35,129,353 (GRCm39) R630H probably damaging Het
Chst14 A G 2: 118,758,256 (GRCm39) H350R probably benign Het
Crispld2 A G 8: 120,757,809 (GRCm39) T385A probably benign Het
Crmp1 A C 5: 37,441,439 (GRCm39) N507T probably damaging Het
Cyp4f40 T A 17: 32,890,143 (GRCm39) I271N probably damaging Het
D630003M21Rik G T 2: 158,052,082 (GRCm39) Q670K possibly damaging Het
Ddx42 T C 11: 106,127,822 (GRCm39) I342T probably damaging Het
Dnah9 T A 11: 65,740,839 (GRCm39) I4116F probably damaging Het
Ehd2 T C 7: 15,684,683 (GRCm39) H372R probably benign Het
Gja8 C A 3: 96,827,092 (GRCm39) C190F probably damaging Het
Gm8297 A T 14: 16,165,939 (GRCm39) D72V possibly damaging Het
Golgb1 A G 16: 36,739,092 (GRCm39) D2518G probably benign Het
Hsd17b12 C A 2: 93,863,986 (GRCm39) M285I probably benign Het
Hus1 T C 11: 8,950,133 (GRCm39) E196G probably damaging Het
Ift70a2 T C 2: 75,807,273 (GRCm39) N413S probably benign Het
Irf2 G A 8: 47,260,314 (GRCm39) R82Q probably damaging Het
Irx2 A G 13: 72,779,493 (GRCm39) D259G possibly damaging Het
Jph1 T A 1: 17,074,602 (GRCm39) Q472L probably benign Het
Kif2a T C 13: 107,124,490 (GRCm39) Q142R probably benign Het
Lonp1 T C 17: 56,929,515 (GRCm39) Y174C probably damaging Het
Mapk14 T C 17: 28,965,271 (GRCm39) F348L probably damaging Het
Marchf10 G T 11: 105,281,054 (GRCm39) D410E probably benign Het
Mff A T 1: 82,724,802 (GRCm39) probably null Het
Mtrex A T 13: 113,009,443 (GRCm39) D985E probably benign Het
Necab3 G A 2: 154,388,200 (GRCm39) R271C probably damaging Het
Nlrp4e T A 7: 23,021,182 (GRCm39) F556L possibly damaging Het
Nt5c2 T C 19: 46,878,385 (GRCm39) K425E probably benign Het
Ofcc1 A T 13: 40,296,302 (GRCm39) W511R probably damaging Het
Or1j18 A C 2: 36,624,342 (GRCm39) E3A probably benign Het
Or2v1 T A 11: 49,025,496 (GRCm39) I159N possibly damaging Het
Or4k77 T C 2: 111,199,748 (GRCm39) I257T probably benign Het
Or52p2 T A 7: 102,238,090 (GRCm39) probably benign Het
P2rx2 G C 5: 110,488,210 (GRCm39) A448G possibly damaging Het
Pcnx2 A T 8: 126,618,757 (GRCm39) N56K possibly damaging Het
Pdzd7 A C 19: 45,028,657 (GRCm39) M162R possibly damaging Het
Phyhd1 A G 2: 30,156,782 (GRCm39) M1V probably null Het
Plaat3 T C 19: 7,556,660 (GRCm39) C154R probably benign Het
Plekha5 A G 6: 140,534,950 (GRCm39) E1126G possibly damaging Het
Plekhm1 A T 11: 103,287,886 (GRCm39) V87D probably damaging Het
Pole G A 5: 110,445,332 (GRCm39) probably null Het
Pramel22 A G 4: 143,381,123 (GRCm39) L300P probably benign Het
R3hcc1 T C 14: 69,942,957 (GRCm39) M207V probably benign Het
R3hcc1l T A 19: 42,552,403 (GRCm39) S467T probably damaging Het
Rasgrp4 G T 7: 28,842,527 (GRCm39) R267L probably damaging Het
Rbm20 T C 19: 53,838,567 (GRCm39) I848T probably benign Het
Rims2 T C 15: 39,061,923 (GRCm39) S56P possibly damaging Het
Rmc1 G A 18: 12,314,656 (GRCm39) D289N probably damaging Het
Sacs T A 14: 61,447,222 (GRCm39) D3089E probably benign Het
Sall2 C T 14: 52,553,521 (GRCm39) G16R probably damaging Het
Scgb1b19 G A 7: 32,987,912 (GRCm39) C93Y probably damaging Het
Scn3a T A 2: 65,297,334 (GRCm39) K1442* probably null Het
Sepsecs A G 5: 52,801,391 (GRCm39) S424P probably damaging Het
Set G T 2: 29,960,323 (GRCm39) V219F probably benign Het
Sh3tc1 A T 5: 35,868,295 (GRCm39) F390I probably damaging Het
Simc1 G A 13: 54,695,143 (GRCm39) V1269M probably damaging Het
Ska3 T G 14: 58,047,512 (GRCm39) D341A probably damaging Het
Slc16a10 A T 10: 39,913,411 (GRCm39) probably null Het
Srgap1 T A 10: 121,761,872 (GRCm39) N92I probably damaging Het
Sspo T C 6: 48,431,624 (GRCm39) V639A probably damaging Het
Stk11 A T 10: 79,961,271 (GRCm39) probably benign Het
Sult5a1 G A 8: 123,872,180 (GRCm39) H221Y probably benign Het
Sytl3 T A 17: 7,003,977 (GRCm39) M559K probably benign Het
Tab2 A C 10: 7,794,897 (GRCm39) D528E possibly damaging Het
Tbc1d15 A G 10: 115,057,492 (GRCm39) I218T possibly damaging Het
Tenm4 T A 7: 96,423,221 (GRCm39) M672K possibly damaging Het
Tent4b A T 8: 88,979,182 (GRCm39) Q561L probably benign Het
Tfrc A G 16: 32,437,985 (GRCm39) K346R probably benign Het
Thsd1 G T 8: 22,733,114 (GRCm39) G54W probably damaging Het
Tmprss15 A T 16: 78,800,275 (GRCm39) L618I probably damaging Het
Top3a T C 11: 60,633,790 (GRCm39) S769G probably benign Het
Trp63 C A 16: 25,686,974 (GRCm39) P396Q possibly damaging Het
Uggt1 T C 1: 36,247,065 (GRCm39) S311G probably damaging Het
Usp10 G A 8: 120,678,740 (GRCm39) E574K possibly damaging Het
Wfdc6b T A 2: 164,459,822 (GRCm39) I148K probably damaging Het
Zcchc2 T G 1: 105,945,982 (GRCm39) I474R probably damaging Het
Zdhhc2 A G 8: 40,900,182 (GRCm39) K82R probably benign Het
Zfp273 A G 13: 67,974,135 (GRCm39) D421G possibly damaging Het
Zfp280d T C 9: 72,238,601 (GRCm39) I639T probably damaging Het
Zfp429 A T 13: 67,538,558 (GRCm39) C295* probably null Het
Other mutations in Clca3a1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00664:Clca3a1 APN 3 144,733,660 (GRCm39) missense probably benign 0.01
IGL00768:Clca3a1 APN 3 144,461,012 (GRCm39) missense probably damaging 0.96
IGL00862:Clca3a1 APN 3 144,730,332 (GRCm39) missense possibly damaging 0.89
IGL00895:Clca3a1 APN 3 144,730,357 (GRCm39) missense probably damaging 1.00
IGL00969:Clca3a1 APN 3 144,714,719 (GRCm39) missense possibly damaging 0.80
IGL01331:Clca3a1 APN 3 144,453,273 (GRCm39) missense probably damaging 1.00
IGL01398:Clca3a1 APN 3 144,722,512 (GRCm39) missense possibly damaging 0.81
IGL01447:Clca3a1 APN 3 144,713,539 (GRCm39) missense probably benign 0.00
IGL01455:Clca3a1 APN 3 144,713,539 (GRCm39) missense probably benign 0.00
IGL01457:Clca3a1 APN 3 144,713,539 (GRCm39) missense probably benign 0.00
IGL01458:Clca3a1 APN 3 144,713,539 (GRCm39) missense probably benign 0.00
IGL01462:Clca3a1 APN 3 144,713,539 (GRCm39) missense probably benign 0.00
IGL01473:Clca3a1 APN 3 144,713,539 (GRCm39) missense probably benign 0.00
IGL01488:Clca3a1 APN 3 144,713,539 (GRCm39) missense probably benign 0.00
IGL01490:Clca3a1 APN 3 144,713,539 (GRCm39) missense probably benign 0.00
IGL01632:Clca3a1 APN 3 144,733,202 (GRCm39) missense probably damaging 1.00
IGL01895:Clca3a1 APN 3 144,453,333 (GRCm39) nonsense probably null
IGL01896:Clca3a1 APN 3 144,721,438 (GRCm39) missense possibly damaging 0.79
IGL01940:Clca3a1 APN 3 144,452,737 (GRCm39) missense probably benign 0.25
IGL02162:Clca3a1 APN 3 144,460,564 (GRCm39) missense probably damaging 0.98
IGL02200:Clca3a1 APN 3 144,457,690 (GRCm39) splice site probably benign
IGL02411:Clca3a1 APN 3 144,733,763 (GRCm39) missense possibly damaging 0.89
IGL03093:Clca3a1 APN 3 144,453,262 (GRCm39) missense probably damaging 0.99
IGL03156:Clca3a1 APN 3 144,719,672 (GRCm39) missense probably damaging 1.00
Lucha UTSW 3 144,455,450 (GRCm39) missense probably damaging 1.00
R0256:Clca3a1 UTSW 3 144,436,640 (GRCm39) missense probably damaging 0.98
R0472:Clca3a1 UTSW 3 144,733,106 (GRCm39) missense probably damaging 1.00
R0513:Clca3a1 UTSW 3 144,466,323 (GRCm39) critical splice donor site probably null
R0543:Clca3a1 UTSW 3 144,454,155 (GRCm39) splice site probably benign
R0571:Clca3a1 UTSW 3 144,713,550 (GRCm39) missense probably damaging 1.00
R0585:Clca3a1 UTSW 3 144,738,386 (GRCm39) missense probably benign 0.16
R0586:Clca3a1 UTSW 3 144,738,350 (GRCm39) missense probably benign 0.45
R0791:Clca3a1 UTSW 3 144,710,615 (GRCm39) missense probably benign 0.01
R1187:Clca3a1 UTSW 3 144,715,504 (GRCm39) missense probably benign 0.30
R1522:Clca3a1 UTSW 3 144,460,932 (GRCm39) missense probably benign 0.01
R1713:Clca3a1 UTSW 3 144,730,307 (GRCm39) missense probably benign 0.00
R1739:Clca3a1 UTSW 3 144,713,539 (GRCm39) missense probably benign 0.00
R1744:Clca3a1 UTSW 3 144,452,596 (GRCm39) missense probably damaging 0.99
R1873:Clca3a1 UTSW 3 144,452,590 (GRCm39) missense probably damaging 0.99
R2079:Clca3a1 UTSW 3 144,713,534 (GRCm39) missense possibly damaging 0.80
R2129:Clca3a1 UTSW 3 144,722,526 (GRCm39) missense probably damaging 1.00
R2178:Clca3a1 UTSW 3 144,711,863 (GRCm39) missense probably damaging 1.00
R2234:Clca3a1 UTSW 3 144,714,829 (GRCm39) missense possibly damaging 0.93
R2235:Clca3a1 UTSW 3 144,714,829 (GRCm39) missense possibly damaging 0.93
R2238:Clca3a1 UTSW 3 144,457,766 (GRCm39) missense possibly damaging 0.94
R2240:Clca3a1 UTSW 3 144,714,746 (GRCm39) missense probably damaging 1.00
R2278:Clca3a1 UTSW 3 144,463,785 (GRCm39) missense probably damaging 0.99
R2516:Clca3a1 UTSW 3 144,443,619 (GRCm39) splice site probably null
R3737:Clca3a1 UTSW 3 144,436,482 (GRCm39) missense probably benign 0.01
R3751:Clca3a1 UTSW 3 144,724,424 (GRCm39) missense probably benign 0.01
R3974:Clca3a1 UTSW 3 144,738,400 (GRCm39) missense probably damaging 1.00
R3975:Clca3a1 UTSW 3 144,738,400 (GRCm39) missense probably damaging 1.00
R3981:Clca3a1 UTSW 3 144,461,070 (GRCm39) missense probably benign 0.00
R3982:Clca3a1 UTSW 3 144,461,070 (GRCm39) missense probably benign 0.00
R3983:Clca3a1 UTSW 3 144,461,070 (GRCm39) missense probably benign 0.00
R4038:Clca3a1 UTSW 3 144,460,994 (GRCm39) missense probably benign 0.35
R4382:Clca3a1 UTSW 3 144,466,483 (GRCm39) start codon destroyed probably benign 0.08
R4409:Clca3a1 UTSW 3 144,711,788 (GRCm39) missense probably damaging 1.00
R4543:Clca3a1 UTSW 3 144,452,749 (GRCm39) missense probably damaging 1.00
R4586:Clca3a1 UTSW 3 144,722,619 (GRCm39) missense probably damaging 1.00
R4751:Clca3a1 UTSW 3 144,710,609 (GRCm39) missense possibly damaging 0.89
R4766:Clca3a1 UTSW 3 144,455,473 (GRCm39) missense probably damaging 1.00
R4894:Clca3a1 UTSW 3 144,719,662 (GRCm39) missense probably damaging 0.99
R4899:Clca3a1 UTSW 3 144,443,722 (GRCm39) missense probably damaging 1.00
R4909:Clca3a1 UTSW 3 144,730,324 (GRCm39) missense probably damaging 1.00
R4916:Clca3a1 UTSW 3 144,721,605 (GRCm39) missense probably benign 0.01
R4941:Clca3a1 UTSW 3 144,721,414 (GRCm39) missense probably damaging 1.00
R4942:Clca3a1 UTSW 3 144,710,524 (GRCm39) missense probably benign 0.02
R5044:Clca3a1 UTSW 3 144,713,689 (GRCm39) splice site probably null
R5090:Clca3a1 UTSW 3 144,443,633 (GRCm39) missense probably benign 0.01
R5091:Clca3a1 UTSW 3 144,436,483 (GRCm39) missense probably benign 0.00
R5205:Clca3a1 UTSW 3 144,452,545 (GRCm39) missense possibly damaging 0.68
R5248:Clca3a1 UTSW 3 144,442,897 (GRCm39) missense possibly damaging 0.62
R5354:Clca3a1 UTSW 3 144,442,766 (GRCm39) missense possibly damaging 0.77
R5451:Clca3a1 UTSW 3 144,733,747 (GRCm39) missense probably damaging 1.00
R5618:Clca3a1 UTSW 3 144,710,738 (GRCm39) missense probably benign 0.00
R5724:Clca3a1 UTSW 3 144,714,833 (GRCm39) missense probably benign 0.01
R5871:Clca3a1 UTSW 3 144,460,642 (GRCm39) missense probably damaging 1.00
R5898:Clca3a1 UTSW 3 144,722,522 (GRCm39) missense possibly damaging 0.89
R5907:Clca3a1 UTSW 3 144,455,403 (GRCm39) intron probably benign
R5976:Clca3a1 UTSW 3 144,452,636 (GRCm39) missense probably damaging 1.00
R6190:Clca3a1 UTSW 3 144,463,821 (GRCm39) missense probably benign 0.40
R6193:Clca3a1 UTSW 3 144,464,993 (GRCm39) missense possibly damaging 0.65
R6238:Clca3a1 UTSW 3 144,714,716 (GRCm39) missense probably benign 0.09
R6263:Clca3a1 UTSW 3 144,455,539 (GRCm39) missense probably damaging 1.00
R6299:Clca3a1 UTSW 3 144,464,275 (GRCm39) missense probably damaging 0.99
R6327:Clca3a1 UTSW 3 144,436,558 (GRCm39) missense probably benign 0.02
R6497:Clca3a1 UTSW 3 144,465,020 (GRCm39) missense possibly damaging 0.81
R6542:Clca3a1 UTSW 3 144,465,021 (GRCm39) missense probably benign 0.01
R6547:Clca3a1 UTSW 3 144,442,708 (GRCm39) missense probably damaging 1.00
R6590:Clca3a1 UTSW 3 144,719,644 (GRCm39) missense probably damaging 1.00
R6591:Clca3a1 UTSW 3 144,719,644 (GRCm39) missense probably damaging 1.00
R6592:Clca3a1 UTSW 3 144,719,644 (GRCm39) missense probably damaging 1.00
R6690:Clca3a1 UTSW 3 144,719,644 (GRCm39) missense probably damaging 1.00
R6691:Clca3a1 UTSW 3 144,719,644 (GRCm39) missense probably damaging 1.00
R6729:Clca3a1 UTSW 3 144,711,727 (GRCm39) missense probably damaging 1.00
R6759:Clca3a1 UTSW 3 144,455,450 (GRCm39) missense probably damaging 1.00
R6805:Clca3a1 UTSW 3 144,724,428 (GRCm39) missense probably damaging 1.00
R7032:Clca3a1 UTSW 3 144,453,329 (GRCm39) missense probably benign 0.07
R7063:Clca3a1 UTSW 3 144,460,967 (GRCm39) missense probably damaging 0.97
R7106:Clca3a1 UTSW 3 144,733,190 (GRCm39) missense probably damaging 0.98
R7121:Clca3a1 UTSW 3 144,717,567 (GRCm39) missense probably damaging 1.00
R7127:Clca3a1 UTSW 3 144,711,806 (GRCm39) missense probably damaging 1.00
R7139:Clca3a1 UTSW 3 144,461,063 (GRCm39) missense possibly damaging 0.58
R7212:Clca3a1 UTSW 3 144,711,727 (GRCm39) missense probably damaging 1.00
R7444:Clca3a1 UTSW 3 144,733,193 (GRCm39) missense probably damaging 1.00
R7446:Clca3a1 UTSW 3 144,733,188 (GRCm39) missense possibly damaging 0.65
R7535:Clca3a1 UTSW 3 144,724,328 (GRCm39) missense probably damaging 0.99
R7638:Clca3a1 UTSW 3 144,457,723 (GRCm39) missense probably damaging 1.00
R7663:Clca3a1 UTSW 3 144,442,797 (GRCm39) missense probably benign 0.02
R7798:Clca3a1 UTSW 3 144,463,723 (GRCm39) missense probably damaging 1.00
R7892:Clca3a1 UTSW 3 144,436,579 (GRCm39) missense probably benign 0.00
R8096:Clca3a1 UTSW 3 144,455,446 (GRCm39) missense probably damaging 1.00
R8305:Clca3a1 UTSW 3 144,464,927 (GRCm39) splice site probably benign
R8416:Clca3a1 UTSW 3 144,460,914 (GRCm39) critical splice donor site probably null
R8437:Clca3a1 UTSW 3 144,710,822 (GRCm39) missense probably benign 0.00
R8446:Clca3a1 UTSW 3 144,454,248 (GRCm39) missense probably damaging 0.97
R8474:Clca3a1 UTSW 3 144,710,792 (GRCm39) missense possibly damaging 0.77
R8496:Clca3a1 UTSW 3 144,453,182 (GRCm39) makesense probably null
R8766:Clca3a1 UTSW 3 144,714,939 (GRCm39) splice site probably benign
R8884:Clca3a1 UTSW 3 144,719,757 (GRCm39) missense probably benign 0.35
R9014:Clca3a1 UTSW 3 144,442,731 (GRCm39) missense probably benign 0.01
R9049:Clca3a1 UTSW 3 144,733,143 (GRCm39) missense probably benign 0.01
R9128:Clca3a1 UTSW 3 144,463,795 (GRCm39) missense probably damaging 1.00
R9306:Clca3a1 UTSW 3 144,730,339 (GRCm39) missense probably damaging 1.00
R9601:Clca3a1 UTSW 3 144,453,310 (GRCm39) missense probably benign 0.27
R9623:Clca3a1 UTSW 3 144,719,698 (GRCm39) missense probably benign 0.03
X0020:Clca3a1 UTSW 3 144,738,421 (GRCm39) missense possibly damaging 0.89
Z1088:Clca3a1 UTSW 3 144,452,714 (GRCm39) missense probably damaging 1.00
Z1176:Clca3a1 UTSW 3 144,719,682 (GRCm39) missense probably damaging 0.99
Predicted Primers PCR Primer
(F):5'- CAGGCACCGAATAATTTAAGATGGG -3'
(R):5'- AATGCTTGCCCATTTCCGTG -3'

Sequencing Primer
(F):5'- AAGGAAAGAACTGAACTTGAAGGTC -3'
(R):5'- CCGTGTATCATCAAGTCAGCTAAG -3'
Posted On 2019-11-26