Incidental Mutation 'R7792:Ccdc180'
ID599926
Institutional Source Beutler Lab
Gene Symbol Ccdc180
Ensembl Gene ENSMUSG00000035539
Gene Namecoiled-coil domain containing 180
SynonymsE230008N13Rik, LOC381522
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R7792 (G1)
Quality Score225.009
Status Not validated
Chromosome4
Chromosomal Location45890303-45950774 bp(+) (GRCm38)
Type of Mutationcritical splice donor site (2 bp from exon)
DNA Base Change (assembly) T to C at 45890389 bp
ZygosityHeterozygous
Amino Acid Change
Ref Sequence ENSEMBL: ENSMUSP00000136714 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000030011] [ENSMUST00000107782] [ENSMUST00000107783] [ENSMUST00000178561]
Predicted Effect probably benign
Transcript: ENSMUST00000030011
SMART Domains Protein: ENSMUSP00000030011
Gene: ENSMUSG00000028327

DomainStartEndE-ValueType
Pfam:RBP_receptor 13 602 8.7e-228 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000107782
SMART Domains Protein: ENSMUSP00000103411
Gene: ENSMUSG00000028327

DomainStartEndE-ValueType
Pfam:RBP_receptor 1 512 2.8e-221 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000107783
SMART Domains Protein: ENSMUSP00000103412
Gene: ENSMUSG00000028327

DomainStartEndE-ValueType
Pfam:RBP_receptor 12 603 1e-254 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000149903
SMART Domains Protein: ENSMUSP00000119784
Gene: ENSMUSG00000035539

DomainStartEndE-ValueType
low complexity region 25 42 N/A INTRINSIC
coiled coil region 90 117 N/A INTRINSIC
Pfam:DUF4455 141 609 2e-189 PFAM
low complexity region 628 642 N/A INTRINSIC
low complexity region 658 675 N/A INTRINSIC
coiled coil region 710 780 N/A INTRINSIC
coiled coil region 945 979 N/A INTRINSIC
low complexity region 1100 1123 N/A INTRINSIC
Pfam:DUF4456 1169 1372 9.5e-77 PFAM
Predicted Effect probably null
Transcript: ENSMUST00000178561
SMART Domains Protein: ENSMUSP00000136714
Gene: ENSMUSG00000035539

DomainStartEndE-ValueType
low complexity region 32 49 N/A INTRINSIC
coiled coil region 98 125 N/A INTRINSIC
Pfam:DUF4455 148 616 7.3e-189 PFAM
low complexity region 635 649 N/A INTRINSIC
low complexity region 665 682 N/A INTRINSIC
coiled coil region 718 788 N/A INTRINSIC
coiled coil region 1121 1155 N/A INTRINSIC
low complexity region 1275 1298 N/A INTRINSIC
Pfam:DUF4456 1344 1547 2.2e-76 PFAM
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.7%
  • 20x: 98.9%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene contains a coiled-coil domain. Alternative splicing results in multiple transcript variants encoding different isoforms. A single nucleotide polymorphism (SNP) in this gene has been associated with increased susceptibility to Behcet's Disease (PMID: 19442274). [provided by RefSeq, Dec 2016]
Allele List at MGI
Other mutations in this stock
Total: 96 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
3110002H16Rik G A 18: 12,181,599 D289N probably damaging Het
Aars G T 8: 111,043,264 V332F possibly damaging Het
Abhd15 T A 11: 77,518,734 S425T probably benign Het
Acads A T 5: 115,112,781 F152L probably damaging Het
Acpp T A 9: 104,326,966 H43L probably damaging Het
Adora2a A G 10: 75,333,646 S315G probably benign Het
Agxt2 A T 15: 10,381,386 D242V probably damaging Het
Alx4 A G 2: 93,642,711 D18G probably damaging Het
Ankrd11 A G 8: 122,884,231 S2639P probably damaging Het
Arhgap35 A T 7: 16,561,528 V1204D possibly damaging Het
Arid2 A G 15: 96,369,375 T579A probably benign Het
B4galt1 C T 4: 40,809,373 G332S probably benign Het
B4galt4 C A 16: 38,757,810 Y206* probably null Het
Bcl2l14 A T 6: 134,432,314 T284S possibly damaging Het
Bop1 C T 15: 76,454,348 V465M probably damaging Het
Cacna1b A T 2: 24,677,965 L1037H probably damaging Het
Cadm2 G A 16: 66,771,637 T254M probably benign Het
Ccdc7a A T 8: 128,892,437 D875E possibly damaging Het
Cenpu A G 8: 46,562,467 D139G possibly damaging Het
Cep57l1 A T 10: 41,722,940 C292* probably null Het
Chst14 A G 2: 118,927,775 H350R probably benign Het
Clca3a1 T A 3: 144,749,731 I434F possibly damaging Het
Crispld2 A G 8: 120,031,070 T385A probably benign Het
Crmp1 A C 5: 37,284,095 N507T probably damaging Het
Cyp4f40 T A 17: 32,671,169 I271N probably damaging Het
D630003M21Rik G T 2: 158,210,162 Q670K possibly damaging Het
Ddx42 T C 11: 106,236,996 I342T probably damaging Het
Dnah9 T A 11: 65,850,013 I4116F probably damaging Het
Ehd2 T C 7: 15,950,758 H372R probably benign Het
Gja8 C A 3: 96,919,776 C190F probably damaging Het
Gm13088 A G 4: 143,654,553 L300P probably benign Het
Gm8297 A T 14: 4,984,945 D72V possibly damaging Het
Golgb1 A G 16: 36,918,730 D2518G probably benign Het
Hsd17b12 C A 2: 94,033,641 M285I probably benign Het
Hus1 T C 11: 9,000,133 E196G probably damaging Het
Irf2 G A 8: 46,807,279 R82Q probably damaging Het
Irx2 A G 13: 72,631,374 D259G possibly damaging Het
Jph1 T A 1: 17,004,378 Q472L probably benign Het
Kif2a T C 13: 106,987,982 Q142R probably benign Het
Lonp1 T C 17: 56,622,515 Y174C probably damaging Het
Mapk14 T C 17: 28,746,297 F348L probably damaging Het
March10 G T 11: 105,390,228 D410E probably benign Het
Mff A T 1: 82,747,081 probably null Het
Necab3 G A 2: 154,546,280 R271C probably damaging Het
Nlrp4e T A 7: 23,321,757 F556L possibly damaging Het
Nt5c2 T C 19: 46,889,946 K425E probably benign Het
Ofcc1 A T 13: 40,142,826 W511R probably damaging Het
Olfr1283 T C 2: 111,369,403 I257T probably benign Het
Olfr347 A C 2: 36,734,330 E3A probably benign Het
Olfr551 T A 7: 102,588,883 probably benign Het
Olfr56 T A 11: 49,134,669 I159N possibly damaging Het
P2rx2 G C 5: 110,340,344 A448G possibly damaging Het
Papd5 A T 8: 88,252,554 Q561L probably benign Het
Pcnx2 A T 8: 125,892,018 N56K possibly damaging Het
Pdzd7 A C 19: 45,040,218 M162R possibly damaging Het
Phyhd1 A G 2: 30,266,770 M1V probably null Het
Pla2g16 T C 19: 7,579,295 C154R probably benign Het
Plekha5 A G 6: 140,589,224 E1126G possibly damaging Het
Plekhm1 A T 11: 103,397,060 V87D probably damaging Het
R3hcc1 T C 14: 69,705,508 M207V probably benign Het
R3hcc1l T A 19: 42,563,964 S467T probably damaging Het
Rasgrp4 G T 7: 29,143,102 R267L probably damaging Het
Rbm20 T C 19: 53,850,136 I848T probably benign Het
Rims2 T C 15: 39,198,528 S56P possibly damaging Het
Sacs T A 14: 61,209,773 D3089E probably benign Het
Sall2 C T 14: 52,316,064 G16R probably damaging Het
Scgb1b19 G A 7: 33,288,487 C93Y probably damaging Het
Scn3a T A 2: 65,466,990 K1442* probably null Het
Sepsecs A G 5: 52,644,049 S424P probably damaging Het
Set G T 2: 30,070,311 V219F probably benign Het
Sh3tc1 A T 5: 35,710,951 F390I probably damaging Het
Simc1 G A 13: 54,547,330 V1269M probably damaging Het
Ska3 T G 14: 57,810,055 D341A probably damaging Het
Skiv2l2 A T 13: 112,872,909 D985E probably benign Het
Srgap1 T A 10: 121,925,967 N92I probably damaging Het
Sspo T C 6: 48,454,690 V639A probably damaging Het
Stk11 A T 10: 80,125,437 probably benign Het
Sult5a1 G A 8: 123,145,441 H221Y probably benign Het
Sytl3 T A 17: 6,736,578 M559K probably benign Het
Tab2 A C 10: 7,919,133 D528E possibly damaging Het
Tbc1d15 A G 10: 115,221,587 I218T possibly damaging Het
Tenm4 T A 7: 96,774,014 M672K possibly damaging Het
Tfrc A G 16: 32,619,167 K346R probably benign Het
Thsd1 G T 8: 22,243,098 G54W probably damaging Het
Tmprss15 A T 16: 79,003,387 L618I probably damaging Het
Top3a T C 11: 60,742,964 S769G probably benign Het
Trp63 C A 16: 25,868,224 P396Q possibly damaging Het
Ttc30a2 T C 2: 75,976,929 N413S probably benign Het
Uggt1 T C 1: 36,207,984 S311G probably damaging Het
Usp10 G A 8: 119,952,001 E574K possibly damaging Het
Wfdc6b T A 2: 164,617,902 I148K probably damaging Het
Zcchc2 T G 1: 106,018,252 I474R probably damaging Het
Zdhhc2 A G 8: 40,447,141 K82R probably benign Het
Zfp273 A G 13: 67,826,016 D421G possibly damaging Het
Zfp280d T C 9: 72,331,319 I639T probably damaging Het
Zfp429 A T 13: 67,390,439 C295* probably null Het
Other mutations in Ccdc180
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01369:Ccdc180 APN 4 45900256 missense probably benign
IGL01713:Ccdc180 APN 4 45921025 critical splice donor site probably null
IGL01915:Ccdc180 APN 4 45904544 missense probably damaging 0.98
IGL01935:Ccdc180 APN 4 45906889 missense possibly damaging 0.71
IGL02539:Ccdc180 APN 4 45921005 missense probably damaging 1.00
IGL02982:Ccdc180 APN 4 45903840 splice site probably benign
IGL03071:Ccdc180 APN 4 45903840 splice site probably benign
IGL03146:Ccdc180 APN 4 45903840 splice site probably benign
PIT4687001:Ccdc180 UTSW 4 45949526 missense probably damaging 1.00
R0049:Ccdc180 UTSW 4 45930119 critical splice acceptor site probably null
R0049:Ccdc180 UTSW 4 45930119 critical splice acceptor site probably null
R0054:Ccdc180 UTSW 4 45890900 missense probably benign 0.01
R0054:Ccdc180 UTSW 4 45890900 missense probably benign 0.01
R0080:Ccdc180 UTSW 4 45896205 missense probably null 0.00
R0082:Ccdc180 UTSW 4 45896205 missense probably null 0.00
R0126:Ccdc180 UTSW 4 45912866 critical splice donor site probably null
R0193:Ccdc180 UTSW 4 45914803 missense probably benign 0.01
R0276:Ccdc180 UTSW 4 45923534 missense probably damaging 1.00
R0362:Ccdc180 UTSW 4 45923551 missense probably damaging 1.00
R0380:Ccdc180 UTSW 4 45930197 critical splice donor site probably null
R0468:Ccdc180 UTSW 4 45923271 missense possibly damaging 0.87
R0539:Ccdc180 UTSW 4 45922010 missense probably damaging 0.97
R0543:Ccdc180 UTSW 4 45900041 nonsense probably null
R0546:Ccdc180 UTSW 4 45904597 missense possibly damaging 0.71
R0612:Ccdc180 UTSW 4 45927969 missense probably damaging 0.98
R0792:Ccdc180 UTSW 4 45927975 missense possibly damaging 0.92
R1056:Ccdc180 UTSW 4 45916375 missense probably benign 0.01
R1099:Ccdc180 UTSW 4 45914225 missense probably benign 0.03
R1136:Ccdc180 UTSW 4 45914589 missense probably benign 0.00
R1263:Ccdc180 UTSW 4 45903887 missense possibly damaging 0.85
R1331:Ccdc180 UTSW 4 45909359 missense possibly damaging 0.51
R1522:Ccdc180 UTSW 4 45927975 missense possibly damaging 0.92
R1819:Ccdc180 UTSW 4 45926195 missense possibly damaging 0.84
R2022:Ccdc180 UTSW 4 45944418 missense probably benign 0.18
R2056:Ccdc180 UTSW 4 45932477 missense probably benign 0.03
R2219:Ccdc180 UTSW 4 45944949 missense probably damaging 1.00
R2228:Ccdc180 UTSW 4 45948856 critical splice donor site probably null
R2229:Ccdc180 UTSW 4 45948856 critical splice donor site probably null
R2255:Ccdc180 UTSW 4 45921996 missense probably damaging 1.00
R2427:Ccdc180 UTSW 4 45929545 missense probably benign 0.03
R3001:Ccdc180 UTSW 4 45899988 missense probably benign
R3002:Ccdc180 UTSW 4 45899988 missense probably benign
R3003:Ccdc180 UTSW 4 45899988 missense probably benign
R3110:Ccdc180 UTSW 4 45900470 missense possibly damaging 0.86
R3111:Ccdc180 UTSW 4 45900470 missense possibly damaging 0.86
R3112:Ccdc180 UTSW 4 45900470 missense possibly damaging 0.86
R3898:Ccdc180 UTSW 4 45912799 missense possibly damaging 0.71
R4022:Ccdc180 UTSW 4 45904560 nonsense probably null
R4084:Ccdc180 UTSW 4 45950632 missense probably benign 0.19
R4377:Ccdc180 UTSW 4 45941877 missense probably damaging 1.00
R4595:Ccdc180 UTSW 4 45945023 missense probably damaging 0.98
R4637:Ccdc180 UTSW 4 45914443 missense probably benign
R4811:Ccdc180 UTSW 4 45928020 missense probably damaging 1.00
R4825:Ccdc180 UTSW 4 45912794 missense possibly damaging 0.93
R4858:Ccdc180 UTSW 4 45923244 missense probably damaging 1.00
R4888:Ccdc180 UTSW 4 45909308 missense probably damaging 0.98
R4940:Ccdc180 UTSW 4 45917453 missense probably damaging 0.96
R4940:Ccdc180 UTSW 4 45917508 missense probably damaging 1.00
R5042:Ccdc180 UTSW 4 45916255 missense probably damaging 0.98
R5119:Ccdc180 UTSW 4 45914603 missense possibly damaging 0.72
R5177:Ccdc180 UTSW 4 45917508 missense probably damaging 1.00
R5311:Ccdc180 UTSW 4 45917556 missense probably damaging 1.00
R5333:Ccdc180 UTSW 4 45890935 missense possibly damaging 0.53
R5448:Ccdc180 UTSW 4 45920913 missense probably damaging 1.00
R5510:Ccdc180 UTSW 4 45928046 missense probably damaging 0.96
R6018:Ccdc180 UTSW 4 45926235 missense probably damaging 1.00
R6108:Ccdc180 UTSW 4 45911389 missense possibly damaging 0.71
R6283:Ccdc180 UTSW 4 45902486 missense possibly damaging 0.85
R6483:Ccdc180 UTSW 4 45921950 missense probably benign 0.32
R6618:Ccdc180 UTSW 4 45950708 missense probably damaging 1.00
R7017:Ccdc180 UTSW 4 45940934 missense possibly damaging 0.84
R7205:Ccdc180 UTSW 4 45914588 missense probably benign
R7341:Ccdc180 UTSW 4 45898644 missense possibly damaging 0.85
R7351:Ccdc180 UTSW 4 45903887 missense possibly damaging 0.85
R7418:Ccdc180 UTSW 4 45904616 missense probably damaging 0.98
R7492:Ccdc180 UTSW 4 45930009 splice site probably null
R7573:Ccdc180 UTSW 4 45922015 missense probably benign 0.33
R7639:Ccdc180 UTSW 4 45928043 missense possibly damaging 0.93
R7806:Ccdc180 UTSW 4 45912801 missense possibly damaging 0.85
R7812:Ccdc180 UTSW 4 45906952 critical splice donor site probably null
R7840:Ccdc180 UTSW 4 45900461 missense possibly damaging 0.71
R7842:Ccdc180 UTSW 4 45909428 missense probably benign 0.00
R7923:Ccdc180 UTSW 4 45900461 missense possibly damaging 0.71
R7925:Ccdc180 UTSW 4 45909428 missense probably benign 0.00
X0017:Ccdc180 UTSW 4 45909350 missense possibly damaging 0.86
Z1176:Ccdc180 UTSW 4 45916406 missense probably damaging 1.00
Z1176:Ccdc180 UTSW 4 45920910 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- CTTTTAAAGGGCGCTCCAAG -3'
(R):5'- TGTCAGATGGGACTGGAACC -3'

Sequencing Primer
(F):5'- GAGTTTCACTACTCCACGTGGG -3'
(R):5'- TCAGATGGGACTGGAACCCTAGTC -3'
Posted On2019-11-26