Incidental Mutation 'R7792:Plekha5'
ID599935
Institutional Source Beutler Lab
Gene Symbol Plekha5
Ensembl Gene ENSMUSG00000030231
Gene Namepleckstrin homology domain containing, family A member 5
SynonymsPEPP2, Tg(AMH-cre)1Flor, Gt(Ayu21)9Imeg, AMH-Cre, 2810431N21Rik, Ayu21-9
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.218) question?
Stock #R7792 (G1)
Quality Score225.009
Status Validated
Chromosome6
Chromosomal Location140424054-140597110 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 140589224 bp
ZygosityHeterozygous
Amino Acid Change Glutamic Acid to Glycine at position 1126 (E1126G)
Ref Sequence ENSEMBL: ENSMUSP00000084904 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000087622] [ENSMUST00000203012] [ENSMUST00000203483] [ENSMUST00000203517] [ENSMUST00000204080] [ENSMUST00000204145] [ENSMUST00000205026] [ENSMUST00000213444]
Predicted Effect possibly damaging
Transcript: ENSMUST00000087622
AA Change: E1126G

PolyPhen 2 Score 0.795 (Sensitivity: 0.85; Specificity: 0.93)
SMART Domains Protein: ENSMUSP00000084904
Gene: ENSMUSG00000030231
AA Change: E1126G

DomainStartEndE-ValueType
WW 12 44 1.51e-3 SMART
WW 58 90 2.17e-4 SMART
PH 171 271 1.85e-17 SMART
Blast:PH 592 715 7e-39 BLAST
coiled coil region 747 781 N/A INTRINSIC
low complexity region 896 916 N/A INTRINSIC
low complexity region 924 938 N/A INTRINSIC
low complexity region 1206 1224 N/A INTRINSIC
low complexity region 1243 1258 N/A INTRINSIC
Predicted Effect possibly damaging
Transcript: ENSMUST00000203012
AA Change: E647G

PolyPhen 2 Score 0.663 (Sensitivity: 0.86; Specificity: 0.91)
SMART Domains Protein: ENSMUSP00000145499
Gene: ENSMUSG00000030231
AA Change: E647G

DomainStartEndE-ValueType
Blast:PH 210 250 2e-8 BLAST
coiled coil region 268 302 N/A INTRINSIC
low complexity region 417 437 N/A INTRINSIC
low complexity region 445 459 N/A INTRINSIC
low complexity region 727 745 N/A INTRINSIC
Predicted Effect possibly damaging
Transcript: ENSMUST00000203483
AA Change: E181G

PolyPhen 2 Score 0.785 (Sensitivity: 0.85; Specificity: 0.93)
SMART Domains Protein: ENSMUSP00000145219
Gene: ENSMUSG00000030231
AA Change: E181G

DomainStartEndE-ValueType
low complexity region 261 279 N/A INTRINSIC
low complexity region 298 313 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000203517
SMART Domains Protein: ENSMUSP00000145478
Gene: ENSMUSG00000030231

DomainStartEndE-ValueType
WW 12 44 9e-6 SMART
WW 58 90 1.3e-6 SMART
PH 171 271 8.6e-20 SMART
Blast:PH 586 697 3e-15 BLAST
coiled coil region 702 736 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000203955
Predicted Effect possibly damaging
Transcript: ENSMUST00000204080
AA Change: E594G

PolyPhen 2 Score 0.816 (Sensitivity: 0.84; Specificity: 0.93)
SMART Domains Protein: ENSMUSP00000144872
Gene: ENSMUSG00000030231
AA Change: E594G

DomainStartEndE-ValueType
Blast:PH 220 260 1e-8 BLAST
coiled coil region 278 312 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000204145
SMART Domains Protein: ENSMUSP00000145457
Gene: ENSMUSG00000030231

DomainStartEndE-ValueType
WW 12 44 9e-6 SMART
WW 58 90 1.3e-6 SMART
Blast:PH 114 151 6e-14 BLAST
PDB:2DKP|A 163 196 1e-5 PDB
Predicted Effect possibly damaging
Transcript: ENSMUST00000205026
AA Change: E539G

PolyPhen 2 Score 0.697 (Sensitivity: 0.86; Specificity: 0.92)
SMART Domains Protein: ENSMUSP00000144973
Gene: ENSMUSG00000030231
AA Change: E539G

DomainStartEndE-ValueType
Blast:PH 165 205 1e-8 BLAST
coiled coil region 223 257 N/A INTRINSIC
low complexity region 619 637 N/A INTRINSIC
Predicted Effect possibly damaging
Transcript: ENSMUST00000213444
AA Change: E453G

PolyPhen 2 Score 0.816 (Sensitivity: 0.84; Specificity: 0.93)
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.7%
  • 20x: 98.9%
Validation Efficiency 100% (97/97)
Allele List at MGI
Other mutations in this stock
Total: 99 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
3110002H16Rik G A 18: 12,181,599 D289N probably damaging Het
Aars G T 8: 111,043,264 V332F possibly damaging Het
Abhd15 T A 11: 77,518,734 S425T probably benign Het
Acads A T 5: 115,112,781 F152L probably damaging Het
Acpp T A 9: 104,326,966 H43L probably damaging Het
Adora2a A G 10: 75,333,646 S315G probably benign Het
Agxt2 A T 15: 10,381,386 D242V probably damaging Het
Alx4 A G 2: 93,642,711 D18G probably damaging Het
Ankrd11 A G 8: 122,884,231 S2639P probably damaging Het
Arhgap35 A T 7: 16,561,528 V1204D possibly damaging Het
Arid2 A G 15: 96,369,375 T579A probably benign Het
B4galt1 C T 4: 40,809,373 G332S probably benign Het
B4galt4 C A 16: 38,757,810 Y206* probably null Het
Bcl2l14 A T 6: 134,432,314 T284S possibly damaging Het
Bop1 C T 15: 76,454,348 V465M probably damaging Het
Cacna1b A T 2: 24,677,965 L1037H probably damaging Het
Cadm2 G A 16: 66,771,637 T254M probably benign Het
Ccdc180 T C 4: 45,890,389 probably null Het
Ccdc7a A T 8: 128,892,437 D875E possibly damaging Het
Cenpu A G 8: 46,562,467 D139G possibly damaging Het
Cep57l1 A T 10: 41,722,940 C292* probably null Het
Cep89 G A 7: 35,429,928 R630H probably damaging Het
Chst14 A G 2: 118,927,775 H350R probably benign Het
Clca3a1 T A 3: 144,749,731 I434F possibly damaging Het
Crispld2 A G 8: 120,031,070 T385A probably benign Het
Crmp1 A C 5: 37,284,095 N507T probably damaging Het
Cyp4f40 T A 17: 32,671,169 I271N probably damaging Het
D630003M21Rik G T 2: 158,210,162 Q670K possibly damaging Het
Ddx42 T C 11: 106,236,996 I342T probably damaging Het
Dnah9 T A 11: 65,850,013 I4116F probably damaging Het
Ehd2 T C 7: 15,950,758 H372R probably benign Het
Gja8 C A 3: 96,919,776 C190F probably damaging Het
Gm13088 A G 4: 143,654,553 L300P probably benign Het
Gm8297 A T 14: 4,984,945 D72V possibly damaging Het
Golgb1 A G 16: 36,918,730 D2518G probably benign Het
Hsd17b12 C A 2: 94,033,641 M285I probably benign Het
Hus1 T C 11: 9,000,133 E196G probably damaging Het
Irf2 G A 8: 46,807,279 R82Q probably damaging Het
Irx2 A G 13: 72,631,374 D259G possibly damaging Het
Jph1 T A 1: 17,004,378 Q472L probably benign Het
Kif2a T C 13: 106,987,982 Q142R probably benign Het
Lonp1 T C 17: 56,622,515 Y174C probably damaging Het
Mapk14 T C 17: 28,746,297 F348L probably damaging Het
March10 G T 11: 105,390,228 D410E probably benign Het
Mff A T 1: 82,747,081 probably null Het
Necab3 G A 2: 154,546,280 R271C probably damaging Het
Nlrp4e T A 7: 23,321,757 F556L possibly damaging Het
Nt5c2 T C 19: 46,889,946 K425E probably benign Het
Ofcc1 A T 13: 40,142,826 W511R probably damaging Het
Olfr1283 T C 2: 111,369,403 I257T probably benign Het
Olfr347 A C 2: 36,734,330 E3A probably benign Het
Olfr551 T A 7: 102,588,883 probably benign Het
Olfr56 T A 11: 49,134,669 I159N possibly damaging Het
P2rx2 G C 5: 110,340,344 A448G possibly damaging Het
Papd5 A T 8: 88,252,554 Q561L probably benign Het
Pcnx2 A T 8: 125,892,018 N56K possibly damaging Het
Pdzd7 A C 19: 45,040,218 M162R possibly damaging Het
Phyhd1 A G 2: 30,266,770 M1V probably null Het
Pla2g16 T C 19: 7,579,295 C154R probably benign Het
Plekhm1 A T 11: 103,397,060 V87D probably damaging Het
Pole G A 5: 110,297,466 probably null Het
R3hcc1 T C 14: 69,705,508 M207V probably benign Het
R3hcc1l T A 19: 42,563,964 S467T probably damaging Het
Rasgrp4 G T 7: 29,143,102 R267L probably damaging Het
Rbm20 T C 19: 53,850,136 I848T probably benign Het
Rims2 T C 15: 39,198,528 S56P possibly damaging Het
Sacs T A 14: 61,209,773 D3089E probably benign Het
Sall2 C T 14: 52,316,064 G16R probably damaging Het
Scgb1b19 G A 7: 33,288,487 C93Y probably damaging Het
Scn3a T A 2: 65,466,990 K1442* probably null Het
Sepsecs A G 5: 52,644,049 S424P probably damaging Het
Set G T 2: 30,070,311 V219F probably benign Het
Sh3tc1 A T 5: 35,710,951 F390I probably damaging Het
Simc1 G A 13: 54,547,330 V1269M probably damaging Het
Ska3 T G 14: 57,810,055 D341A probably damaging Het
Skiv2l2 A T 13: 112,872,909 D985E probably benign Het
Slc16a10 A T 10: 40,037,415 probably null Het
Srgap1 T A 10: 121,925,967 N92I probably damaging Het
Sspo T C 6: 48,454,690 V639A probably damaging Het
Stk11 A T 10: 80,125,437 probably benign Het
Sult5a1 G A 8: 123,145,441 H221Y probably benign Het
Sytl3 T A 17: 6,736,578 M559K probably benign Het
Tab2 A C 10: 7,919,133 D528E possibly damaging Het
Tbc1d15 A G 10: 115,221,587 I218T possibly damaging Het
Tenm4 T A 7: 96,774,014 M672K possibly damaging Het
Tfrc A G 16: 32,619,167 K346R probably benign Het
Thsd1 G T 8: 22,243,098 G54W probably damaging Het
Tmprss15 A T 16: 79,003,387 L618I probably damaging Het
Top3a T C 11: 60,742,964 S769G probably benign Het
Trp63 C A 16: 25,868,224 P396Q possibly damaging Het
Ttc30a2 T C 2: 75,976,929 N413S probably benign Het
Uggt1 T C 1: 36,207,984 S311G probably damaging Het
Usp10 G A 8: 119,952,001 E574K possibly damaging Het
Wfdc6b T A 2: 164,617,902 I148K probably damaging Het
Zcchc2 T G 1: 106,018,252 I474R probably damaging Het
Zdhhc2 A G 8: 40,447,141 K82R probably benign Het
Zfp273 A G 13: 67,826,016 D421G possibly damaging Het
Zfp280d T C 9: 72,331,319 I639T probably damaging Het
Zfp429 A T 13: 67,390,439 C295* probably null Het
Other mutations in Plekha5
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00577:Plekha5 APN 6 140570096 splice site probably benign
IGL00908:Plekha5 APN 6 140550930 missense probably damaging 1.00
IGL01346:Plekha5 APN 6 140534566 splice site probably benign
IGL01380:Plekha5 APN 6 140570316 splice site probably benign
IGL01406:Plekha5 APN 6 140572950 missense probably damaging 0.99
IGL01408:Plekha5 APN 6 140570316 splice site probably benign
IGL01688:Plekha5 APN 6 140569389 missense probably damaging 0.98
IGL01719:Plekha5 APN 6 140570129 missense probably damaging 1.00
IGL01926:Plekha5 APN 6 140525916 missense probably benign 0.12
IGL01936:Plekha5 APN 6 140524895 missense probably damaging 1.00
IGL02326:Plekha5 APN 6 140583850 nonsense probably null
IGL02544:Plekha5 APN 6 140589728 missense possibly damaging 0.78
IGL02573:Plekha5 APN 6 140582016 missense probably damaging 1.00
IGL02704:Plekha5 APN 6 140543866 missense probably damaging 1.00
IGL02959:Plekha5 APN 6 140544178 missense probably damaging 1.00
Doubletime UTSW 6 140525929 nonsense probably null
R0067:Plekha5 UTSW 6 140524903 missense probably damaging 1.00
R0067:Plekha5 UTSW 6 140524903 missense probably damaging 1.00
R0095:Plekha5 UTSW 6 140528597 missense probably damaging 1.00
R0095:Plekha5 UTSW 6 140528597 missense probably damaging 1.00
R0105:Plekha5 UTSW 6 140591747 missense possibly damaging 0.80
R0107:Plekha5 UTSW 6 140591747 missense possibly damaging 0.80
R0359:Plekha5 UTSW 6 140591747 missense possibly damaging 0.80
R0360:Plekha5 UTSW 6 140591747 missense possibly damaging 0.80
R0362:Plekha5 UTSW 6 140591747 missense possibly damaging 0.80
R0363:Plekha5 UTSW 6 140591747 missense possibly damaging 0.80
R0364:Plekha5 UTSW 6 140591747 missense possibly damaging 0.80
R0365:Plekha5 UTSW 6 140591747 missense possibly damaging 0.80
R0833:Plekha5 UTSW 6 140589634 splice site probably benign
R0835:Plekha5 UTSW 6 140568850 nonsense probably null
R0836:Plekha5 UTSW 6 140589634 splice site probably benign
R0944:Plekha5 UTSW 6 140570196 splice site probably benign
R2015:Plekha5 UTSW 6 140534564 critical splice donor site probably null
R2043:Plekha5 UTSW 6 140552804 splice site probably benign
R2086:Plekha5 UTSW 6 140570318 splice site probably null
R2102:Plekha5 UTSW 6 140572877 missense probably damaging 1.00
R2109:Plekha5 UTSW 6 140424216 missense possibly damaging 0.56
R2135:Plekha5 UTSW 6 140580499 missense possibly damaging 0.66
R2150:Plekha5 UTSW 6 140570403 missense probably damaging 1.00
R2211:Plekha5 UTSW 6 140525861 missense possibly damaging 0.56
R2414:Plekha5 UTSW 6 140550856 missense probably damaging 1.00
R2915:Plekha5 UTSW 6 140589199 missense probably damaging 0.96
R3120:Plekha5 UTSW 6 140591641 missense probably benign 0.00
R3924:Plekha5 UTSW 6 140570379 missense possibly damaging 0.78
R4049:Plekha5 UTSW 6 140583871 missense probably damaging 1.00
R4056:Plekha5 UTSW 6 140589232 missense possibly damaging 0.46
R4077:Plekha5 UTSW 6 140555921 intron probably null
R4320:Plekha5 UTSW 6 140543817 missense possibly damaging 0.68
R4343:Plekha5 UTSW 6 140556054 missense probably damaging 0.99
R4359:Plekha5 UTSW 6 140591688 missense probably benign 0.07
R4377:Plekha5 UTSW 6 140579465 missense probably damaging 1.00
R4480:Plekha5 UTSW 6 140526479 missense probably damaging 1.00
R4533:Plekha5 UTSW 6 140570331 missense probably damaging 1.00
R4623:Plekha5 UTSW 6 140551186 missense probably damaging 0.98
R4672:Plekha5 UTSW 6 140524929 missense probably damaging 0.98
R4871:Plekha5 UTSW 6 140525910 missense probably damaging 1.00
R4903:Plekha5 UTSW 6 140586367 missense probably damaging 1.00
R5121:Plekha5 UTSW 6 140579474 missense probably damaging 1.00
R5156:Plekha5 UTSW 6 140426528 missense probably damaging 1.00
R5376:Plekha5 UTSW 6 140551144 missense probably damaging 1.00
R5445:Plekha5 UTSW 6 140552733 nonsense probably null
R5753:Plekha5 UTSW 6 140537004 critical splice acceptor site probably null
R5836:Plekha5 UTSW 6 140426524 missense probably damaging 1.00
R5972:Plekha5 UTSW 6 140572913 missense possibly damaging 0.78
R6196:Plekha5 UTSW 6 140579453 missense probably benign 0.28
R6254:Plekha5 UTSW 6 140586436 missense probably damaging 1.00
R6501:Plekha5 UTSW 6 140525929 nonsense probably null
R6620:Plekha5 UTSW 6 140572875 missense probably damaging 1.00
R6663:Plekha5 UTSW 6 140577290 missense probably damaging 1.00
R6823:Plekha5 UTSW 6 140525858 missense probably benign 0.16
R6992:Plekha5 UTSW 6 140543908 missense probably damaging 1.00
R7196:Plekha5 UTSW 6 140543922 missense possibly damaging 0.83
R7487:Plekha5 UTSW 6 140570333 missense probably benign 0.25
R7493:Plekha5 UTSW 6 140580435 missense probably benign 0.02
R7557:Plekha5 UTSW 6 140426545 missense probably damaging 0.96
R7743:Plekha5 UTSW 6 140555986 missense probably damaging 1.00
R7808:Plekha5 UTSW 6 140583914 missense probably damaging 1.00
R7910:Plekha5 UTSW 6 140526458 missense possibly damaging 0.89
R7991:Plekha5 UTSW 6 140526458 missense possibly damaging 0.89
X0027:Plekha5 UTSW 6 140424423 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- GCCAAACCAAAGTGCTGTAAG -3'
(R):5'- AGAGCTCTCTGACTAAAAGCAC -3'

Sequencing Primer
(F):5'- GAGGATTTCCATACCAGCCTAGG -3'
(R):5'- TCTCTGACTAAAAGCACACCTTAATC -3'
Posted On2019-11-26