Incidental Mutation 'R7792:Ankrd11'
ID599951
Institutional Source Beutler Lab
Gene Symbol Ankrd11
Ensembl Gene ENSMUSG00000035569
Gene Nameankyrin repeat domain 11
Synonyms3010027A04Rik, Yod, 2410104C19Rik, 9530048I21Rik
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R7792 (G1)
Quality Score225.009
Status Not validated
Chromosome8
Chromosomal Location122883822-123042277 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 122884231 bp
ZygosityHeterozygous
Amino Acid Change Serine to Proline at position 2639 (S2639P)
Ref Sequence ENSEMBL: ENSMUSP00000095938 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000098333] [ENSMUST00000098334] [ENSMUST00000127664] [ENSMUST00000172906]
Predicted Effect probably damaging
Transcript: ENSMUST00000098333
AA Change: S2639P

PolyPhen 2 Score 0.970 (Sensitivity: 0.77; Specificity: 0.96)
SMART Domains Protein: ENSMUSP00000095938
Gene: ENSMUSG00000035569
AA Change: S2639P

DomainStartEndE-ValueType
ANK 188 217 2.58e-3 SMART
ANK 221 250 1.31e-4 SMART
ANK 254 283 5.04e-6 SMART
low complexity region 311 324 N/A INTRINSIC
low complexity region 366 377 N/A INTRINSIC
low complexity region 429 440 N/A INTRINSIC
low complexity region 470 487 N/A INTRINSIC
low complexity region 499 521 N/A INTRINSIC
low complexity region 534 549 N/A INTRINSIC
low complexity region 596 609 N/A INTRINSIC
low complexity region 649 669 N/A INTRINSIC
coiled coil region 786 826 N/A INTRINSIC
low complexity region 867 877 N/A INTRINSIC
low complexity region 965 984 N/A INTRINSIC
low complexity region 1040 1055 N/A INTRINSIC
low complexity region 1058 1082 N/A INTRINSIC
low complexity region 1187 1200 N/A INTRINSIC
low complexity region 1204 1227 N/A INTRINSIC
low complexity region 1268 1289 N/A INTRINSIC
low complexity region 1294 1306 N/A INTRINSIC
coiled coil region 1374 1406 N/A INTRINSIC
low complexity region 1476 1496 N/A INTRINSIC
low complexity region 1508 1523 N/A INTRINSIC
low complexity region 1526 1547 N/A INTRINSIC
coiled coil region 1598 1625 N/A INTRINSIC
low complexity region 1770 1781 N/A INTRINSIC
low complexity region 1874 1885 N/A INTRINSIC
low complexity region 1913 1922 N/A INTRINSIC
low complexity region 1969 1979 N/A INTRINSIC
low complexity region 2035 2045 N/A INTRINSIC
low complexity region 2057 2071 N/A INTRINSIC
low complexity region 2162 2179 N/A INTRINSIC
low complexity region 2191 2209 N/A INTRINSIC
low complexity region 2224 2236 N/A INTRINSIC
low complexity region 2250 2263 N/A INTRINSIC
low complexity region 2294 2305 N/A INTRINSIC
low complexity region 2391 2409 N/A INTRINSIC
low complexity region 2445 2455 N/A INTRINSIC
Predicted Effect possibly damaging
Transcript: ENSMUST00000098334
AA Change: S2618P

PolyPhen 2 Score 0.730 (Sensitivity: 0.86; Specificity: 0.92)
SMART Domains Protein: ENSMUSP00000095939
Gene: ENSMUSG00000035569
AA Change: S2618P

DomainStartEndE-ValueType
ANK 167 196 2.58e-3 SMART
ANK 200 229 1.31e-4 SMART
ANK 233 262 5.04e-6 SMART
low complexity region 290 303 N/A INTRINSIC
low complexity region 345 356 N/A INTRINSIC
low complexity region 408 419 N/A INTRINSIC
low complexity region 449 466 N/A INTRINSIC
low complexity region 478 500 N/A INTRINSIC
low complexity region 513 528 N/A INTRINSIC
low complexity region 575 588 N/A INTRINSIC
low complexity region 628 648 N/A INTRINSIC
coiled coil region 765 805 N/A INTRINSIC
low complexity region 846 856 N/A INTRINSIC
low complexity region 944 963 N/A INTRINSIC
low complexity region 1019 1034 N/A INTRINSIC
low complexity region 1037 1061 N/A INTRINSIC
low complexity region 1166 1179 N/A INTRINSIC
low complexity region 1183 1206 N/A INTRINSIC
low complexity region 1247 1268 N/A INTRINSIC
low complexity region 1273 1285 N/A INTRINSIC
coiled coil region 1353 1385 N/A INTRINSIC
low complexity region 1455 1475 N/A INTRINSIC
low complexity region 1487 1502 N/A INTRINSIC
low complexity region 1505 1526 N/A INTRINSIC
coiled coil region 1577 1604 N/A INTRINSIC
low complexity region 1749 1760 N/A INTRINSIC
low complexity region 1853 1864 N/A INTRINSIC
low complexity region 1892 1901 N/A INTRINSIC
low complexity region 1948 1958 N/A INTRINSIC
low complexity region 2014 2024 N/A INTRINSIC
low complexity region 2036 2050 N/A INTRINSIC
low complexity region 2141 2158 N/A INTRINSIC
low complexity region 2170 2188 N/A INTRINSIC
low complexity region 2203 2215 N/A INTRINSIC
low complexity region 2229 2242 N/A INTRINSIC
low complexity region 2273 2284 N/A INTRINSIC
low complexity region 2370 2388 N/A INTRINSIC
low complexity region 2424 2434 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000127664
SMART Domains Protein: ENSMUSP00000118564
Gene: ENSMUSG00000092329

DomainStartEndE-ValueType
Pfam:Glycos_transf_2 104 287 7.4e-31 PFAM
Pfam:Glyco_transf_7C 261 331 4.9e-8 PFAM
RICIN 406 531 9.28e-27 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000172906
Predicted Effect noncoding transcript
Transcript: ENSMUST00000211940
Predicted Effect noncoding transcript
Transcript: ENSMUST00000212728
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.7%
  • 20x: 98.9%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This locus encodes an ankryin repeat domain-containing protein. The encoded protein inhibits ligand-dependent activation of transcription. Mutations in this gene have been associated with KBG syndrome, which is characterized by macrodontia, distinctive craniofacial features, short stature, skeletal anomalies, global developmental delay, seizures and intellectual disability. Alternatively spliced transcript variants have been described. Related pseudogenes exist on chromosomes 2 and X. [provided by RefSeq, Jan 2012]
PHENOTYPE: Mice homozygous for a spontaneous allele die by E9.5, are small and fail to turn. Mice heterozygous for a spontaneous allele exhibit craniofacial abnormalities, decreased weight, osteoporosis and osteopenia. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 96 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
3110002H16Rik G A 18: 12,181,599 D289N probably damaging Het
Aars G T 8: 111,043,264 V332F possibly damaging Het
Abhd15 T A 11: 77,518,734 S425T probably benign Het
Acads A T 5: 115,112,781 F152L probably damaging Het
Acpp T A 9: 104,326,966 H43L probably damaging Het
Adora2a A G 10: 75,333,646 S315G probably benign Het
Agxt2 A T 15: 10,381,386 D242V probably damaging Het
Alx4 A G 2: 93,642,711 D18G probably damaging Het
Arhgap35 A T 7: 16,561,528 V1204D possibly damaging Het
Arid2 A G 15: 96,369,375 T579A probably benign Het
B4galt1 C T 4: 40,809,373 G332S probably benign Het
B4galt4 C A 16: 38,757,810 Y206* probably null Het
Bcl2l14 A T 6: 134,432,314 T284S possibly damaging Het
Bop1 C T 15: 76,454,348 V465M probably damaging Het
Cacna1b A T 2: 24,677,965 L1037H probably damaging Het
Cadm2 G A 16: 66,771,637 T254M probably benign Het
Ccdc180 T C 4: 45,890,389 probably null Het
Ccdc7a A T 8: 128,892,437 D875E possibly damaging Het
Cenpu A G 8: 46,562,467 D139G possibly damaging Het
Cep57l1 A T 10: 41,722,940 C292* probably null Het
Chst14 A G 2: 118,927,775 H350R probably benign Het
Clca3a1 T A 3: 144,749,731 I434F possibly damaging Het
Crispld2 A G 8: 120,031,070 T385A probably benign Het
Crmp1 A C 5: 37,284,095 N507T probably damaging Het
Cyp4f40 T A 17: 32,671,169 I271N probably damaging Het
D630003M21Rik G T 2: 158,210,162 Q670K possibly damaging Het
Ddx42 T C 11: 106,236,996 I342T probably damaging Het
Dnah9 T A 11: 65,850,013 I4116F probably damaging Het
Ehd2 T C 7: 15,950,758 H372R probably benign Het
Gja8 C A 3: 96,919,776 C190F probably damaging Het
Gm13088 A G 4: 143,654,553 L300P probably benign Het
Gm8297 A T 14: 4,984,945 D72V possibly damaging Het
Golgb1 A G 16: 36,918,730 D2518G probably benign Het
Hsd17b12 C A 2: 94,033,641 M285I probably benign Het
Hus1 T C 11: 9,000,133 E196G probably damaging Het
Irf2 G A 8: 46,807,279 R82Q probably damaging Het
Irx2 A G 13: 72,631,374 D259G possibly damaging Het
Jph1 T A 1: 17,004,378 Q472L probably benign Het
Kif2a T C 13: 106,987,982 Q142R probably benign Het
Lonp1 T C 17: 56,622,515 Y174C probably damaging Het
Mapk14 T C 17: 28,746,297 F348L probably damaging Het
March10 G T 11: 105,390,228 D410E probably benign Het
Mff A T 1: 82,747,081 probably null Het
Necab3 G A 2: 154,546,280 R271C probably damaging Het
Nlrp4e T A 7: 23,321,757 F556L possibly damaging Het
Nt5c2 T C 19: 46,889,946 K425E probably benign Het
Ofcc1 A T 13: 40,142,826 W511R probably damaging Het
Olfr1283 T C 2: 111,369,403 I257T probably benign Het
Olfr347 A C 2: 36,734,330 E3A probably benign Het
Olfr551 T A 7: 102,588,883 probably benign Het
Olfr56 T A 11: 49,134,669 I159N possibly damaging Het
P2rx2 G C 5: 110,340,344 A448G possibly damaging Het
Papd5 A T 8: 88,252,554 Q561L probably benign Het
Pcnx2 A T 8: 125,892,018 N56K possibly damaging Het
Pdzd7 A C 19: 45,040,218 M162R possibly damaging Het
Phyhd1 A G 2: 30,266,770 M1V probably null Het
Pla2g16 T C 19: 7,579,295 C154R probably benign Het
Plekha5 A G 6: 140,589,224 E1126G possibly damaging Het
Plekhm1 A T 11: 103,397,060 V87D probably damaging Het
R3hcc1 T C 14: 69,705,508 M207V probably benign Het
R3hcc1l T A 19: 42,563,964 S467T probably damaging Het
Rasgrp4 G T 7: 29,143,102 R267L probably damaging Het
Rbm20 T C 19: 53,850,136 I848T probably benign Het
Rims2 T C 15: 39,198,528 S56P possibly damaging Het
Sacs T A 14: 61,209,773 D3089E probably benign Het
Sall2 C T 14: 52,316,064 G16R probably damaging Het
Scgb1b19 G A 7: 33,288,487 C93Y probably damaging Het
Scn3a T A 2: 65,466,990 K1442* probably null Het
Sepsecs A G 5: 52,644,049 S424P probably damaging Het
Set G T 2: 30,070,311 V219F probably benign Het
Sh3tc1 A T 5: 35,710,951 F390I probably damaging Het
Simc1 G A 13: 54,547,330 V1269M probably damaging Het
Ska3 T G 14: 57,810,055 D341A probably damaging Het
Skiv2l2 A T 13: 112,872,909 D985E probably benign Het
Srgap1 T A 10: 121,925,967 N92I probably damaging Het
Sspo T C 6: 48,454,690 V639A probably damaging Het
Stk11 A T 10: 80,125,437 probably benign Het
Sult5a1 G A 8: 123,145,441 H221Y probably benign Het
Sytl3 T A 17: 6,736,578 M559K probably benign Het
Tab2 A C 10: 7,919,133 D528E possibly damaging Het
Tbc1d15 A G 10: 115,221,587 I218T possibly damaging Het
Tenm4 T A 7: 96,774,014 M672K possibly damaging Het
Tfrc A G 16: 32,619,167 K346R probably benign Het
Thsd1 G T 8: 22,243,098 G54W probably damaging Het
Tmprss15 A T 16: 79,003,387 L618I probably damaging Het
Top3a T C 11: 60,742,964 S769G probably benign Het
Trp63 C A 16: 25,868,224 P396Q possibly damaging Het
Ttc30a2 T C 2: 75,976,929 N413S probably benign Het
Uggt1 T C 1: 36,207,984 S311G probably damaging Het
Usp10 G A 8: 119,952,001 E574K possibly damaging Het
Wfdc6b T A 2: 164,617,902 I148K probably damaging Het
Zcchc2 T G 1: 106,018,252 I474R probably damaging Het
Zdhhc2 A G 8: 40,447,141 K82R probably benign Het
Zfp273 A G 13: 67,826,016 D421G possibly damaging Het
Zfp280d T C 9: 72,331,319 I639T probably damaging Het
Zfp429 A T 13: 67,390,439 C295* probably null Het
Other mutations in Ankrd11
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00949:Ankrd11 APN 8 122908728 missense possibly damaging 0.59
IGL00971:Ankrd11 APN 8 122895353 missense probably damaging 1.00
IGL01017:Ankrd11 APN 8 122894728 missense probably damaging 1.00
IGL01137:Ankrd11 APN 8 122884336 missense probably damaging 0.99
IGL01659:Ankrd11 APN 8 122895371 missense probably damaging 1.00
IGL01920:Ankrd11 APN 8 122915897 splice site probably benign
IGL01964:Ankrd11 APN 8 122889736 missense probably damaging 0.97
IGL02131:Ankrd11 APN 8 122894410 missense probably damaging 1.00
IGL02226:Ankrd11 APN 8 122892245 missense probably damaging 1.00
IGL02549:Ankrd11 APN 8 122891293 missense probably damaging 1.00
IGL02642:Ankrd11 APN 8 122890651 missense probably damaging 1.00
IGL02643:Ankrd11 APN 8 122892322 missense probably damaging 0.98
IGL02861:Ankrd11 APN 8 122895827 missense probably damaging 0.99
IGL03086:Ankrd11 APN 8 122894510 missense probably damaging 1.00
IGL03336:Ankrd11 APN 8 122891843 missense probably benign 0.00
anchors UTSW 8 122895770 missense probably damaging 0.99
away UTSW 8 122891953 missense probably damaging 1.00
bluebell UTSW 8 122891785 missense probably damaging 0.97
Navy UTSW 8 122908734 nonsense probably null
R0051:Ankrd11 UTSW 8 122889742 missense probably damaging 1.00
R0051:Ankrd11 UTSW 8 122889742 missense probably damaging 1.00
R0110:Ankrd11 UTSW 8 122892175 missense possibly damaging 0.95
R0281:Ankrd11 UTSW 8 122895568 missense probably benign 0.01
R0450:Ankrd11 UTSW 8 122892175 missense possibly damaging 0.95
R0481:Ankrd11 UTSW 8 122900036 missense probably damaging 1.00
R0542:Ankrd11 UTSW 8 122895770 missense probably damaging 0.99
R0606:Ankrd11 UTSW 8 122892832 missense probably benign 0.04
R0702:Ankrd11 UTSW 8 122889766 missense probably damaging 1.00
R0730:Ankrd11 UTSW 8 122891953 missense probably damaging 1.00
R0737:Ankrd11 UTSW 8 122895836 missense probably damaging 0.99
R1401:Ankrd11 UTSW 8 122893050 missense probably benign 0.23
R1464:Ankrd11 UTSW 8 122892724 missense probably damaging 1.00
R1464:Ankrd11 UTSW 8 122892724 missense probably damaging 1.00
R1470:Ankrd11 UTSW 8 122899724 missense probably damaging 0.98
R1470:Ankrd11 UTSW 8 122899724 missense probably damaging 0.98
R1641:Ankrd11 UTSW 8 122891746 missense probably benign 0.03
R1950:Ankrd11 UTSW 8 122889869 missense probably damaging 1.00
R2004:Ankrd11 UTSW 8 122902422 critical splice donor site probably null
R2401:Ankrd11 UTSW 8 122908734 nonsense probably null
R2425:Ankrd11 UTSW 8 122893163 missense possibly damaging 0.86
R2830:Ankrd11 UTSW 8 122892196 missense probably damaging 1.00
R2910:Ankrd11 UTSW 8 122908798 missense probably damaging 1.00
R2911:Ankrd11 UTSW 8 122908798 missense probably damaging 1.00
R3736:Ankrd11 UTSW 8 122891785 missense probably damaging 0.97
R3738:Ankrd11 UTSW 8 122896715 unclassified probably benign
R3739:Ankrd11 UTSW 8 122896715 unclassified probably benign
R3813:Ankrd11 UTSW 8 122891378 missense probably benign
R4012:Ankrd11 UTSW 8 122892417 missense probably damaging 0.98
R4183:Ankrd11 UTSW 8 122899676 missense possibly damaging 0.88
R4213:Ankrd11 UTSW 8 122891026 missense probably benign 0.00
R4469:Ankrd11 UTSW 8 122896587 missense probably damaging 1.00
R4482:Ankrd11 UTSW 8 122893489 missense probably damaging 1.00
R4935:Ankrd11 UTSW 8 122900183 missense probably benign 0.02
R4940:Ankrd11 UTSW 8 122889821 missense probably damaging 1.00
R5145:Ankrd11 UTSW 8 122891204 utr 3 prime probably benign
R5154:Ankrd11 UTSW 8 122893139 missense probably damaging 1.00
R5230:Ankrd11 UTSW 8 122890477 missense probably benign 0.11
R5283:Ankrd11 UTSW 8 122884182 missense probably damaging 1.00
R5377:Ankrd11 UTSW 8 122893714 unclassified probably null
R5513:Ankrd11 UTSW 8 122892520 missense probably benign 0.38
R5518:Ankrd11 UTSW 8 122890994 missense possibly damaging 0.93
R5549:Ankrd11 UTSW 8 122890378 missense probably benign 0.02
R5579:Ankrd11 UTSW 8 122884231 missense probably damaging 0.97
R5595:Ankrd11 UTSW 8 122894304 nonsense probably null
R5650:Ankrd11 UTSW 8 122887397 missense probably damaging 0.99
R5717:Ankrd11 UTSW 8 122892638 missense possibly damaging 0.92
R5753:Ankrd11 UTSW 8 122895304 missense possibly damaging 0.90
R5782:Ankrd11 UTSW 8 122900017 missense probably damaging 1.00
R5812:Ankrd11 UTSW 8 122893805 unclassified probably null
R5823:Ankrd11 UTSW 8 122895790 missense probably benign 0.12
R5900:Ankrd11 UTSW 8 122891066 missense probably benign 0.00
R5975:Ankrd11 UTSW 8 122889749 missense possibly damaging 0.93
R5979:Ankrd11 UTSW 8 122892400 missense probably damaging 1.00
R6000:Ankrd11 UTSW 8 122891195 missense possibly damaging 0.73
R6145:Ankrd11 UTSW 8 122892661 missense probably damaging 1.00
R6252:Ankrd11 UTSW 8 122893822 missense possibly damaging 0.87
R6302:Ankrd11 UTSW 8 122889989 missense probably benign
R6457:Ankrd11 UTSW 8 122908764 missense probably damaging 1.00
R6513:Ankrd11 UTSW 8 122890180 missense probably benign 0.02
R6582:Ankrd11 UTSW 8 122891629 missense probably benign 0.00
R6738:Ankrd11 UTSW 8 122891921 missense probably damaging 0.99
R6865:Ankrd11 UTSW 8 122894944 missense probably benign 0.41
R6913:Ankrd11 UTSW 8 122894911 missense probably benign 0.01
R7101:Ankrd11 UTSW 8 122895455 missense probably benign 0.35
R7116:Ankrd11 UTSW 8 122896130 missense probably damaging 1.00
R7477:Ankrd11 UTSW 8 122894385 missense possibly damaging 0.91
R7534:Ankrd11 UTSW 8 122894410 missense probably damaging 1.00
R7555:Ankrd11 UTSW 8 122887406 missense probably damaging 0.99
R7627:Ankrd11 UTSW 8 122890951 missense possibly damaging 0.63
R7658:Ankrd11 UTSW 8 122893664 missense probably benign
R7721:Ankrd11 UTSW 8 122894759 missense probably damaging 1.00
R7731:Ankrd11 UTSW 8 122895433 missense probably benign 0.12
R8022:Ankrd11 UTSW 8 122887593 missense probably damaging 1.00
RF019:Ankrd11 UTSW 8 122896634 missense probably damaging 1.00
Z1176:Ankrd11 UTSW 8 122895803 missense possibly damaging 0.68
Z1177:Ankrd11 UTSW 8 122900142 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- CTACCTCACTGCATCTGGAG -3'
(R):5'- TCAGGGGATAAACCAGGTTCTG -3'

Sequencing Primer
(F):5'- TCACTGCATCTGGAGGGGAG -3'
(R):5'- GGTCCTGTGGGTGAAGCC -3'
Posted On2019-11-26