Incidental Mutation 'R7792:Kif2a'
ID599976
Institutional Source Beutler Lab
Gene Symbol Kif2a
Ensembl Gene ENSMUSG00000021693
Gene Namekinesin family member 2A
SynonymsKns2, Kif2, M-kinesin
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R7792 (G1)
Quality Score225.009
Status Validated
Chromosome13
Chromosomal Location106958996-107022126 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 106987982 bp
ZygosityHeterozygous
Amino Acid Change Glutamine to Arginine at position 142 (Q142R)
Ref Sequence ENSEMBL: ENSMUSP00000022204 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000022204] [ENSMUST00000117423] [ENSMUST00000117539] [ENSMUST00000122233] [ENSMUST00000159772]
Predicted Effect probably benign
Transcript: ENSMUST00000022204
AA Change: Q142R

PolyPhen 2 Score 0.060 (Sensitivity: 0.94; Specificity: 0.84)
SMART Domains Protein: ENSMUSP00000022204
Gene: ENSMUSG00000021693
AA Change: Q142R

DomainStartEndE-ValueType
low complexity region 73 85 N/A INTRINSIC
low complexity region 159 183 N/A INTRINSIC
KISc 220 560 6.56e-147 SMART
low complexity region 613 625 N/A INTRINSIC
coiled coil region 660 698 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000117423
SMART Domains Protein: ENSMUSP00000113921
Gene: ENSMUSG00000021693

DomainStartEndE-ValueType
low complexity region 46 58 N/A INTRINSIC
low complexity region 113 137 N/A INTRINSIC
KISc 174 514 6.56e-147 SMART
low complexity region 567 579 N/A INTRINSIC
coiled coil region 614 652 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000117539
AA Change: Q126R

PolyPhen 2 Score 0.049 (Sensitivity: 0.94; Specificity: 0.83)
SMART Domains Protein: ENSMUSP00000113361
Gene: ENSMUSG00000021693
AA Change: Q126R

DomainStartEndE-ValueType
low complexity region 57 69 N/A INTRINSIC
low complexity region 143 167 N/A INTRINSIC
KISc 204 544 6.56e-147 SMART
low complexity region 597 609 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000122233
AA Change: Q115R

PolyPhen 2 Score 0.002 (Sensitivity: 0.99; Specificity: 0.30)
SMART Domains Protein: ENSMUSP00000112715
Gene: ENSMUSG00000021693
AA Change: Q115R

DomainStartEndE-ValueType
low complexity region 46 58 N/A INTRINSIC
low complexity region 132 156 N/A INTRINSIC
KISc 193 533 4.33e-147 SMART
low complexity region 542 556 N/A INTRINSIC
low complexity region 624 636 N/A INTRINSIC
coiled coil region 671 709 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000146395
SMART Domains Protein: ENSMUSP00000116070
Gene: ENSMUSG00000021693

DomainStartEndE-ValueType
low complexity region 45 57 N/A INTRINSIC
low complexity region 74 85 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000159772
AA Change: Q142R

PolyPhen 2 Score 0.002 (Sensitivity: 0.99; Specificity: 0.30)
SMART Domains Protein: ENSMUSP00000125644
Gene: ENSMUSG00000021693
AA Change: Q142R

DomainStartEndE-ValueType
low complexity region 73 85 N/A INTRINSIC
low complexity region 159 183 N/A INTRINSIC
KISc 220 560 4.33e-147 SMART
low complexity region 569 583 N/A INTRINSIC
low complexity region 651 663 N/A INTRINSIC
coiled coil region 698 736 N/A INTRINSIC
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.7%
  • 20x: 98.9%
Validation Efficiency 100% (97/97)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene is a plus end-directed motor required for normal mitotic progression. The encoded protein is required for normal spindle activity during mitosis and is necessary for normal brain development. Several transcript variants encoding different isoforms have been found for this gene. [provided by RefSeq, Sep 2011]
PHENOTYPE: Homozygous null mice display neonatal lethality, abnormal lamination of the cerebral cortex, hippocampus and cerebellum, impaired neuronal migration, and abnormal axon outgrowth. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 99 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
3110002H16Rik G A 18: 12,181,599 D289N probably damaging Het
Aars G T 8: 111,043,264 V332F possibly damaging Het
Abhd15 T A 11: 77,518,734 S425T probably benign Het
Acads A T 5: 115,112,781 F152L probably damaging Het
Acpp T A 9: 104,326,966 H43L probably damaging Het
Adora2a A G 10: 75,333,646 S315G probably benign Het
Agxt2 A T 15: 10,381,386 D242V probably damaging Het
Alx4 A G 2: 93,642,711 D18G probably damaging Het
Ankrd11 A G 8: 122,884,231 S2639P probably damaging Het
Arhgap35 A T 7: 16,561,528 V1204D possibly damaging Het
Arid2 A G 15: 96,369,375 T579A probably benign Het
B4galt1 C T 4: 40,809,373 G332S probably benign Het
B4galt4 C A 16: 38,757,810 Y206* probably null Het
Bcl2l14 A T 6: 134,432,314 T284S possibly damaging Het
Bop1 C T 15: 76,454,348 V465M probably damaging Het
Cacna1b A T 2: 24,677,965 L1037H probably damaging Het
Cadm2 G A 16: 66,771,637 T254M probably benign Het
Ccdc180 T C 4: 45,890,389 probably null Het
Ccdc7a A T 8: 128,892,437 D875E possibly damaging Het
Cenpu A G 8: 46,562,467 D139G possibly damaging Het
Cep57l1 A T 10: 41,722,940 C292* probably null Het
Cep89 G A 7: 35,429,928 R630H probably damaging Het
Chst14 A G 2: 118,927,775 H350R probably benign Het
Clca3a1 T A 3: 144,749,731 I434F possibly damaging Het
Crispld2 A G 8: 120,031,070 T385A probably benign Het
Crmp1 A C 5: 37,284,095 N507T probably damaging Het
Cyp4f40 T A 17: 32,671,169 I271N probably damaging Het
D630003M21Rik G T 2: 158,210,162 Q670K possibly damaging Het
Ddx42 T C 11: 106,236,996 I342T probably damaging Het
Dnah9 T A 11: 65,850,013 I4116F probably damaging Het
Ehd2 T C 7: 15,950,758 H372R probably benign Het
Gja8 C A 3: 96,919,776 C190F probably damaging Het
Gm13088 A G 4: 143,654,553 L300P probably benign Het
Gm8297 A T 14: 4,984,945 D72V possibly damaging Het
Golgb1 A G 16: 36,918,730 D2518G probably benign Het
Hsd17b12 C A 2: 94,033,641 M285I probably benign Het
Hus1 T C 11: 9,000,133 E196G probably damaging Het
Irf2 G A 8: 46,807,279 R82Q probably damaging Het
Irx2 A G 13: 72,631,374 D259G possibly damaging Het
Jph1 T A 1: 17,004,378 Q472L probably benign Het
Lonp1 T C 17: 56,622,515 Y174C probably damaging Het
Mapk14 T C 17: 28,746,297 F348L probably damaging Het
March10 G T 11: 105,390,228 D410E probably benign Het
Mff A T 1: 82,747,081 probably null Het
Necab3 G A 2: 154,546,280 R271C probably damaging Het
Nlrp4e T A 7: 23,321,757 F556L possibly damaging Het
Nt5c2 T C 19: 46,889,946 K425E probably benign Het
Ofcc1 A T 13: 40,142,826 W511R probably damaging Het
Olfr1283 T C 2: 111,369,403 I257T probably benign Het
Olfr347 A C 2: 36,734,330 E3A probably benign Het
Olfr551 T A 7: 102,588,883 probably benign Het
Olfr56 T A 11: 49,134,669 I159N possibly damaging Het
P2rx2 G C 5: 110,340,344 A448G possibly damaging Het
Papd5 A T 8: 88,252,554 Q561L probably benign Het
Pcnx2 A T 8: 125,892,018 N56K possibly damaging Het
Pdzd7 A C 19: 45,040,218 M162R possibly damaging Het
Phyhd1 A G 2: 30,266,770 M1V probably null Het
Pla2g16 T C 19: 7,579,295 C154R probably benign Het
Plekha5 A G 6: 140,589,224 E1126G possibly damaging Het
Plekhm1 A T 11: 103,397,060 V87D probably damaging Het
Pole G A 5: 110,297,466 probably null Het
R3hcc1 T C 14: 69,705,508 M207V probably benign Het
R3hcc1l T A 19: 42,563,964 S467T probably damaging Het
Rasgrp4 G T 7: 29,143,102 R267L probably damaging Het
Rbm20 T C 19: 53,850,136 I848T probably benign Het
Rims2 T C 15: 39,198,528 S56P possibly damaging Het
Sacs T A 14: 61,209,773 D3089E probably benign Het
Sall2 C T 14: 52,316,064 G16R probably damaging Het
Scgb1b19 G A 7: 33,288,487 C93Y probably damaging Het
Scn3a T A 2: 65,466,990 K1442* probably null Het
Sepsecs A G 5: 52,644,049 S424P probably damaging Het
Set G T 2: 30,070,311 V219F probably benign Het
Sh3tc1 A T 5: 35,710,951 F390I probably damaging Het
Simc1 G A 13: 54,547,330 V1269M probably damaging Het
Ska3 T G 14: 57,810,055 D341A probably damaging Het
Skiv2l2 A T 13: 112,872,909 D985E probably benign Het
Slc16a10 A T 10: 40,037,415 probably null Het
Srgap1 T A 10: 121,925,967 N92I probably damaging Het
Sspo T C 6: 48,454,690 V639A probably damaging Het
Stk11 A T 10: 80,125,437 probably benign Het
Sult5a1 G A 8: 123,145,441 H221Y probably benign Het
Sytl3 T A 17: 6,736,578 M559K probably benign Het
Tab2 A C 10: 7,919,133 D528E possibly damaging Het
Tbc1d15 A G 10: 115,221,587 I218T possibly damaging Het
Tenm4 T A 7: 96,774,014 M672K possibly damaging Het
Tfrc A G 16: 32,619,167 K346R probably benign Het
Thsd1 G T 8: 22,243,098 G54W probably damaging Het
Tmprss15 A T 16: 79,003,387 L618I probably damaging Het
Top3a T C 11: 60,742,964 S769G probably benign Het
Trp63 C A 16: 25,868,224 P396Q possibly damaging Het
Ttc30a2 T C 2: 75,976,929 N413S probably benign Het
Uggt1 T C 1: 36,207,984 S311G probably damaging Het
Usp10 G A 8: 119,952,001 E574K possibly damaging Het
Wfdc6b T A 2: 164,617,902 I148K probably damaging Het
Zcchc2 T G 1: 106,018,252 I474R probably damaging Het
Zdhhc2 A G 8: 40,447,141 K82R probably benign Het
Zfp273 A G 13: 67,826,016 D421G possibly damaging Het
Zfp280d T C 9: 72,331,319 I639T probably damaging Het
Zfp429 A T 13: 67,390,439 C295* probably null Het
Other mutations in Kif2a
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00934:Kif2a APN 13 106968793 splice site probably benign
IGL01640:Kif2a APN 13 106974552 missense probably damaging 1.00
IGL02524:Kif2a APN 13 106964355 missense possibly damaging 0.82
R0088:Kif2a UTSW 13 106975432 missense probably damaging 1.00
R0276:Kif2a UTSW 13 106976650 splice site probably benign
R1233:Kif2a UTSW 13 106987332 missense probably damaging 1.00
R1345:Kif2a UTSW 13 106993915 missense probably damaging 0.99
R1772:Kif2a UTSW 13 106978132 intron probably benign
R1900:Kif2a UTSW 13 106976995 missense possibly damaging 0.46
R1932:Kif2a UTSW 13 106978091 missense probably benign 0.00
R2364:Kif2a UTSW 13 106976836 missense probably damaging 1.00
R3177:Kif2a UTSW 13 106976756 missense probably damaging 1.00
R3277:Kif2a UTSW 13 106976756 missense probably damaging 1.00
R4646:Kif2a UTSW 13 106962185 missense probably damaging 1.00
R5566:Kif2a UTSW 13 106993924 unclassified probably null 1.00
R5761:Kif2a UTSW 13 106962164 missense probably benign 0.05
R5797:Kif2a UTSW 13 106975376 missense probably damaging 1.00
R6812:Kif2a UTSW 13 106969751 missense probably benign 0.00
R7025:Kif2a UTSW 13 106982594 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- CCTAGCCAGAATTTTAAGTTCAAAAC -3'
(R):5'- CAATTTGTGTATCAGATTTGATATGGG -3'

Sequencing Primer
(F):5'- TGTAAGGCTGACCAAGAG -3'
(R):5'- ATCAGATTTGATATGGGGAGGTC -3'
Posted On2019-11-26