Incidental Mutation 'R7792:Sacs'
ID599981
Institutional Source Beutler Lab
Gene Symbol Sacs
Ensembl Gene ENSMUSG00000048279
Gene Namesacsin
SynonymsE130115J16Rik
Accession Numbers

Genbank: NM_172809; MGI: 1354724; Ensembl: ENSMUST00000119943

Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R7792 (G1)
Quality Score225.009
Status Validated
Chromosome14
Chromosomal Location61138457-61240695 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to A at 61209773 bp
ZygosityHeterozygous
Amino Acid Change Aspartic acid to Glutamic Acid at position 3089 (D3089E)
Ref Sequence ENSEMBL: ENSMUSP00000113377 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000089394] [ENSMUST00000119943]
Predicted Effect probably benign
Transcript: ENSMUST00000089394
SMART Domains Protein: ENSMUSP00000086816
Gene: ENSMUSG00000048279

DomainStartEndE-ValueType
SCOP:d1lm8b_ 8 66 3e-3 SMART
Blast:UBQ 9 81 3e-31 BLAST
Blast:HATPase_c 116 211 2e-10 BLAST
low complexity region 608 623 N/A INTRINSIC
low complexity region 664 673 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000119943
AA Change: D3089E

PolyPhen 2 Score 0.001 (Sensitivity: 0.99; Specificity: 0.15)
SMART Domains Protein: ENSMUSP00000113377
Gene: ENSMUSG00000048279
AA Change: D3089E

DomainStartEndE-ValueType
internal_repeat_1 61 514 1.35e-52 PROSPERO
low complexity region 608 623 N/A INTRINSIC
low complexity region 664 673 N/A INTRINSIC
low complexity region 1019 1033 N/A INTRINSIC
low complexity region 1131 1145 N/A INTRINSIC
low complexity region 1526 1537 N/A INTRINSIC
low complexity region 2454 2463 N/A INTRINSIC
internal_repeat_1 2475 2934 1.35e-52 PROSPERO
low complexity region 3751 3760 N/A INTRINSIC
low complexity region 3997 4012 N/A INTRINSIC
low complexity region 4285 4300 N/A INTRINSIC
Blast:DnaJ 4304 4363 1e-31 BLAST
PDB:1IUR|A 4309 4376 5e-39 PDB
SCOP:d1gh6a_ 4317 4407 2e-3 SMART
HEPN 4454 4570 9.49e-24 SMART
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.7%
  • 20x: 98.9%
Validation Efficiency 100% (97/97)
MGI Phenotype PHENOTYPE: Mice homozygous for a knockout allele exhibit Purkinje cell degeneration with thickened tortuous dendrites and altered mitochondrial dysfunction. [provided by MGI curators]
Allele List at MGI

All alleles(3) : Gene trapped(3)

Other mutations in this stock
Total: 99 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
3110002H16Rik G A 18: 12,181,599 D289N probably damaging Het
Aars G T 8: 111,043,264 V332F possibly damaging Het
Abhd15 T A 11: 77,518,734 S425T probably benign Het
Acads A T 5: 115,112,781 F152L probably damaging Het
Acpp T A 9: 104,326,966 H43L probably damaging Het
Adora2a A G 10: 75,333,646 S315G probably benign Het
Agxt2 A T 15: 10,381,386 D242V probably damaging Het
Alx4 A G 2: 93,642,711 D18G probably damaging Het
Ankrd11 A G 8: 122,884,231 S2639P probably damaging Het
Arhgap35 A T 7: 16,561,528 V1204D possibly damaging Het
Arid2 A G 15: 96,369,375 T579A probably benign Het
B4galt1 C T 4: 40,809,373 G332S probably benign Het
B4galt4 C A 16: 38,757,810 Y206* probably null Het
Bcl2l14 A T 6: 134,432,314 T284S possibly damaging Het
Bop1 C T 15: 76,454,348 V465M probably damaging Het
Cacna1b A T 2: 24,677,965 L1037H probably damaging Het
Cadm2 G A 16: 66,771,637 T254M probably benign Het
Ccdc180 T C 4: 45,890,389 probably null Het
Ccdc7a A T 8: 128,892,437 D875E possibly damaging Het
Cenpu A G 8: 46,562,467 D139G possibly damaging Het
Cep57l1 A T 10: 41,722,940 C292* probably null Het
Cep89 G A 7: 35,429,928 R630H probably damaging Het
Chst14 A G 2: 118,927,775 H350R probably benign Het
Clca3a1 T A 3: 144,749,731 I434F possibly damaging Het
Crispld2 A G 8: 120,031,070 T385A probably benign Het
Crmp1 A C 5: 37,284,095 N507T probably damaging Het
Cyp4f40 T A 17: 32,671,169 I271N probably damaging Het
D630003M21Rik G T 2: 158,210,162 Q670K possibly damaging Het
Ddx42 T C 11: 106,236,996 I342T probably damaging Het
Dnah9 T A 11: 65,850,013 I4116F probably damaging Het
Ehd2 T C 7: 15,950,758 H372R probably benign Het
Gja8 C A 3: 96,919,776 C190F probably damaging Het
Gm13088 A G 4: 143,654,553 L300P probably benign Het
Gm8297 A T 14: 4,984,945 D72V possibly damaging Het
Golgb1 A G 16: 36,918,730 D2518G probably benign Het
Hsd17b12 C A 2: 94,033,641 M285I probably benign Het
Hus1 T C 11: 9,000,133 E196G probably damaging Het
Irf2 G A 8: 46,807,279 R82Q probably damaging Het
Irx2 A G 13: 72,631,374 D259G possibly damaging Het
Jph1 T A 1: 17,004,378 Q472L probably benign Het
Kif2a T C 13: 106,987,982 Q142R probably benign Het
Lonp1 T C 17: 56,622,515 Y174C probably damaging Het
Mapk14 T C 17: 28,746,297 F348L probably damaging Het
March10 G T 11: 105,390,228 D410E probably benign Het
Mff A T 1: 82,747,081 probably null Het
Necab3 G A 2: 154,546,280 R271C probably damaging Het
Nlrp4e T A 7: 23,321,757 F556L possibly damaging Het
Nt5c2 T C 19: 46,889,946 K425E probably benign Het
Ofcc1 A T 13: 40,142,826 W511R probably damaging Het
Olfr1283 T C 2: 111,369,403 I257T probably benign Het
Olfr347 A C 2: 36,734,330 E3A probably benign Het
Olfr551 T A 7: 102,588,883 probably benign Het
Olfr56 T A 11: 49,134,669 I159N possibly damaging Het
P2rx2 G C 5: 110,340,344 A448G possibly damaging Het
Papd5 A T 8: 88,252,554 Q561L probably benign Het
Pcnx2 A T 8: 125,892,018 N56K possibly damaging Het
Pdzd7 A C 19: 45,040,218 M162R possibly damaging Het
Phyhd1 A G 2: 30,266,770 M1V probably null Het
Pla2g16 T C 19: 7,579,295 C154R probably benign Het
Plekha5 A G 6: 140,589,224 E1126G possibly damaging Het
Plekhm1 A T 11: 103,397,060 V87D probably damaging Het
Pole G A 5: 110,297,466 probably null Het
R3hcc1 T C 14: 69,705,508 M207V probably benign Het
R3hcc1l T A 19: 42,563,964 S467T probably damaging Het
Rasgrp4 G T 7: 29,143,102 R267L probably damaging Het
Rbm20 T C 19: 53,850,136 I848T probably benign Het
Rims2 T C 15: 39,198,528 S56P possibly damaging Het
Sall2 C T 14: 52,316,064 G16R probably damaging Het
Scgb1b19 G A 7: 33,288,487 C93Y probably damaging Het
Scn3a T A 2: 65,466,990 K1442* probably null Het
Sepsecs A G 5: 52,644,049 S424P probably damaging Het
Set G T 2: 30,070,311 V219F probably benign Het
Sh3tc1 A T 5: 35,710,951 F390I probably damaging Het
Simc1 G A 13: 54,547,330 V1269M probably damaging Het
Ska3 T G 14: 57,810,055 D341A probably damaging Het
Skiv2l2 A T 13: 112,872,909 D985E probably benign Het
Slc16a10 A T 10: 40,037,415 probably null Het
Srgap1 T A 10: 121,925,967 N92I probably damaging Het
Sspo T C 6: 48,454,690 V639A probably damaging Het
Stk11 A T 10: 80,125,437 probably benign Het
Sult5a1 G A 8: 123,145,441 H221Y probably benign Het
Sytl3 T A 17: 6,736,578 M559K probably benign Het
Tab2 A C 10: 7,919,133 D528E possibly damaging Het
Tbc1d15 A G 10: 115,221,587 I218T possibly damaging Het
Tenm4 T A 7: 96,774,014 M672K possibly damaging Het
Tfrc A G 16: 32,619,167 K346R probably benign Het
Thsd1 G T 8: 22,243,098 G54W probably damaging Het
Tmprss15 A T 16: 79,003,387 L618I probably damaging Het
Top3a T C 11: 60,742,964 S769G probably benign Het
Trp63 C A 16: 25,868,224 P396Q possibly damaging Het
Ttc30a2 T C 2: 75,976,929 N413S probably benign Het
Uggt1 T C 1: 36,207,984 S311G probably damaging Het
Usp10 G A 8: 119,952,001 E574K possibly damaging Het
Wfdc6b T A 2: 164,617,902 I148K probably damaging Het
Zcchc2 T G 1: 106,018,252 I474R probably damaging Het
Zdhhc2 A G 8: 40,447,141 K82R probably benign Het
Zfp273 A G 13: 67,826,016 D421G possibly damaging Het
Zfp280d T C 9: 72,331,319 I639T probably damaging Het
Zfp429 A T 13: 67,390,439 C295* probably null Het
Other mutations in Sacs
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01540:Sacs APN 14 61191635 missense possibly damaging 0.64
IGL01839:Sacs APN 14 61183945 intron probably benign
IGL02024:Sacs APN 14 61189678 missense probably damaging 0.96
IGL02247:Sacs APN 14 61192535 missense probably damaging 1.00
F6893:Sacs UTSW 14 61212976 missense probably benign
IGL03052:Sacs UTSW 14 61207858 missense probably damaging 0.99
R0090:Sacs UTSW 14 61205440 missense probably damaging 1.00
R0102:Sacs UTSW 14 61204568 missense probably damaging 1.00
R0102:Sacs UTSW 14 61204568 missense probably damaging 1.00
R0390:Sacs UTSW 14 61205640 missense possibly damaging 0.92
R0479:Sacs UTSW 14 61191479 missense probably damaging 0.99
R0556:Sacs UTSW 14 61183958 missense probably damaging 0.99
R0673:Sacs UTSW 14 61210215 missense possibly damaging 0.89
R0748:Sacs UTSW 14 61209265 missense probably damaging 0.99
R0931:Sacs UTSW 14 61203495 missense probably benign
R0972:Sacs UTSW 14 61211963 nonsense probably null
R1281:Sacs UTSW 14 61191801 missense probably benign 0.02
R1340:Sacs UTSW 14 61204509 missense probably damaging 0.98
R1351:Sacs UTSW 14 61202761 missense probably benign 0.00
R1499:Sacs UTSW 14 61213704 missense possibly damaging 0.70
R1538:Sacs UTSW 14 61210059 missense probably damaging 0.98
R1581:Sacs UTSW 14 61213679 missense probably damaging 0.96
R1599:Sacs UTSW 14 61203638 missense probably benign
R1631:Sacs UTSW 14 61210732 nonsense probably null
R1635:Sacs UTSW 14 61203828 missense probably damaging 0.98
R1655:Sacs UTSW 14 61191782 missense probably benign
R1660:Sacs UTSW 14 61209009 missense probably damaging 0.99
R1707:Sacs UTSW 14 61209762 missense probably benign 0.01
R1733:Sacs UTSW 14 61205454 missense probably damaging 1.00
R1772:Sacs UTSW 14 61210897 missense probably damaging 1.00
R1976:Sacs UTSW 14 61202895 missense probably benign
R2055:Sacs UTSW 14 61214049 missense probably damaging 0.97
R2083:Sacs UTSW 14 61206506 missense possibly damaging 0.69
R2091:Sacs UTSW 14 61191919 missense possibly damaging 0.95
R2105:Sacs UTSW 14 61173441 missense possibly damaging 0.90
R2109:Sacs UTSW 14 61173453 splice site probably null
R2117:Sacs UTSW 14 61213771 missense probably benign 0.01
R2122:Sacs UTSW 14 61212316 missense probably damaging 1.00
R2148:Sacs UTSW 14 61173378 missense probably damaging 0.97
R2151:Sacs UTSW 14 61209640 missense probably damaging 1.00
R2231:Sacs UTSW 14 61205929 unclassified probably null
R2248:Sacs UTSW 14 61212802 missense probably damaging 1.00
R2271:Sacs UTSW 14 61204660 missense probably benign 0.06
R2314:Sacs UTSW 14 61207759 missense probably benign 0.17
R2436:Sacs UTSW 14 61202905 missense possibly damaging 0.94
R2445:Sacs UTSW 14 61205206 missense probably damaging 1.00
R2512:Sacs UTSW 14 61203080 missense probably benign 0.00
R3434:Sacs UTSW 14 61212303 missense probably damaging 1.00
R3785:Sacs UTSW 14 61183961 missense probably damaging 1.00
R3786:Sacs UTSW 14 61183961 missense probably damaging 1.00
R3796:Sacs UTSW 14 61206121 missense possibly damaging 0.87
R3798:Sacs UTSW 14 61206121 missense possibly damaging 0.87
R3872:Sacs UTSW 14 61148068 missense probably benign 0.30
R3873:Sacs UTSW 14 61192286 missense possibly damaging 0.64
R3892:Sacs UTSW 14 61204387 missense probably damaging 0.98
R4184:Sacs UTSW 14 61213944 missense probably damaging 0.97
R4204:Sacs UTSW 14 61173443 missense possibly damaging 0.93
R4249:Sacs UTSW 14 61203457 missense probably benign 0.02
R4256:Sacs UTSW 14 61206337 missense probably damaging 1.00
R4370:Sacs UTSW 14 61212309 missense probably damaging 1.00
R4445:Sacs UTSW 14 61204686 missense probably benign 0.30
R4503:Sacs UTSW 14 61207603 missense probably damaging 1.00
R4548:Sacs UTSW 14 61191938 missense probably damaging 1.00
R4582:Sacs UTSW 14 61191698 missense probably damaging 1.00
R4613:Sacs UTSW 14 61211797 intron probably null
R4639:Sacs UTSW 14 61207268 missense probably benign 0.12
R4697:Sacs UTSW 14 61212747 missense probably benign 0.19
R4706:Sacs UTSW 14 61204273 missense probably damaging 1.00
R4717:Sacs UTSW 14 61212855 missense probably damaging 1.00
R4777:Sacs UTSW 14 61211809 missense probably damaging 1.00
R4888:Sacs UTSW 14 61212198 missense probably damaging 1.00
R4913:Sacs UTSW 14 61213797 missense probably benign 0.17
R4973:Sacs UTSW 14 61213122 missense probably damaging 1.00
R4986:Sacs UTSW 14 61213043 nonsense probably null
R5090:Sacs UTSW 14 61205253 missense probably damaging 1.00
R5243:Sacs UTSW 14 61205957 nonsense probably null
R5292:Sacs UTSW 14 61211983 missense probably damaging 1.00
R5308:Sacs UTSW 14 61192400 missense probably benign 0.21
R5337:Sacs UTSW 14 61193514 intron probably benign
R5502:Sacs UTSW 14 61206100 missense probably damaging 1.00
R5586:Sacs UTSW 14 61206441 nonsense probably null
R5692:Sacs UTSW 14 61207839 missense probably benign 0.00
R5725:Sacs UTSW 14 61211110 missense probably damaging 1.00
R5854:Sacs UTSW 14 61211547 missense probably damaging 1.00
R5959:Sacs UTSW 14 61212400 missense probably damaging 0.99
R5960:Sacs UTSW 14 61208695 missense probably benign 0.30
R5968:Sacs UTSW 14 61189629 missense probably damaging 0.99
R5983:Sacs UTSW 14 61205199 missense probably damaging 1.00
R5992:Sacs UTSW 14 61205543 missense probably damaging 1.00
R6076:Sacs UTSW 14 61204536 nonsense probably null
R6175:Sacs UTSW 14 61212826 missense possibly damaging 0.82
R6347:Sacs UTSW 14 61211160 missense probably damaging 1.00
R6357:Sacs UTSW 14 61208824 missense possibly damaging 0.47
R6415:Sacs UTSW 14 61205359 missense probably damaging 1.00
R6469:Sacs UTSW 14 61191248 missense probably damaging 1.00
R6503:Sacs UTSW 14 61211361 missense probably benign 0.00
R6523:Sacs UTSW 14 61202961 missense probably damaging 0.99
R6615:Sacs UTSW 14 61208934 missense probably benign 0.15
R6729:Sacs UTSW 14 61210518 missense probably damaging 1.00
R6731:Sacs UTSW 14 61180700 intron probably null
R6797:Sacs UTSW 14 61213073 missense probably damaging 1.00
R6852:Sacs UTSW 14 61179288 missense possibly damaging 0.87
R6922:Sacs UTSW 14 61211425 missense probably damaging 1.00
R7023:Sacs UTSW 14 61208815 missense probably benign 0.04
R7047:Sacs UTSW 14 61213002 missense probably damaging 1.00
R7051:Sacs UTSW 14 61208928 missense probably benign 0.25
R7069:Sacs UTSW 14 61212496 missense probably damaging 1.00
R7082:Sacs UTSW 14 61210517 missense possibly damaging 0.94
R7108:Sacs UTSW 14 61211009 nonsense probably null
R7122:Sacs UTSW 14 61210396 missense probably damaging 1.00
R7194:Sacs UTSW 14 61210089 missense possibly damaging 0.95
R7214:Sacs UTSW 14 61191792 missense probably benign
R7221:Sacs UTSW 14 61208806 missense probably damaging 0.99
R7274:Sacs UTSW 14 61214081 missense possibly damaging 0.88
R7344:Sacs UTSW 14 61207444 missense possibly damaging 0.81
R7440:Sacs UTSW 14 61191605 missense probably benign 0.10
R7474:Sacs UTSW 14 61211178 missense probably benign 0.04
R7512:Sacs UTSW 14 61204430 missense probably benign 0.04
R7641:Sacs UTSW 14 61202871 missense probably damaging 0.97
R7649:Sacs UTSW 14 61203228 missense possibly damaging 0.53
R7703:Sacs UTSW 14 61206090 missense possibly damaging 0.81
R7805:Sacs UTSW 14 61203591 missense not run
R7822:Sacs UTSW 14 61192203 missense probably benign 0.03
R7882:Sacs UTSW 14 61207071 missense probably benign 0.02
R7965:Sacs UTSW 14 61207071 missense probably benign 0.02
R8031:Sacs UTSW 14 61204191 missense probably damaging 0.96
R8064:Sacs UTSW 14 61192175 missense possibly damaging 0.92
X0067:Sacs UTSW 14 61208019 missense probably damaging 1.00
Z1176:Sacs UTSW 14 61210830 nonsense probably null
Z1176:Sacs UTSW 14 61213200 missense probably damaging 1.00
Z1177:Sacs UTSW 14 61191551 missense possibly damaging 0.48
Z1177:Sacs UTSW 14 61207981 missense possibly damaging 0.93
Predicted Primers PCR Primer
(F):5'- TACTACAGGATGAATTACAGCACC -3'
(R):5'- AATCTGCAAGACACTGTCCAG -3'

Sequencing Primer
(F):5'- GAATTACAGCACCTTAAAAATGCAG -3'
(R):5'- ACTGTCCAGTGTAATGAGTAGGG -3'
Posted On2019-11-26