Mutagenetix > Incidental Mutations

Incidental Mutation 'R7792:Rims2'

599984

Institutional Source

Beutler Lab

Gene Symbol

Rims2

Ensembl Gene

ENSMUSG00000037386

Gene Name

regulating synaptic membrane exocytosis 2

Synonyms

2810036I15Rik, Syt3-rs, RIM2

MMRRC Submission

Accession Numbers

Is this an essential gene?

Possibly essential (E-score: 0.619) question?

Stock #

R7792 (G1)

Quality Score

225.009

Status

Validated

Chromosome

Chromosomal Location

39198261-39684372 bp(+) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

T to C at 39198528 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Serine to Proline at position 56 (S56P)

Ref Sequence

ENSEMBL: ENSMUSP00000048719 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000042917] [ENSMUST00000082054] [ENSMUST00000227243]

AlphaFold

Q9EQZ7

Predicted Effect

possibly damaging
Transcript: ENSMUST00000042917
AA Change: S56P

PolyPhen 2 Score 0.695 (Sensitivity: 0.86; Specificity: 0.92)

SMART Domains

Protein: ENSMUSP00000048719
Gene: ENSMUSG00000037386
AA Change: S56P

Domain	Start	End	E-Value	Type
low complexity region	3	24	N/A	INTRINSIC
Pfam:FYVE_2	30	154	9.5e-18	PFAM
low complexity region	315	335	N/A	INTRINSIC
low complexity region	492	498	N/A	INTRINSIC
low complexity region	511	521	N/A	INTRINSIC
low complexity region	527	540	N/A	INTRINSIC
PDZ	646	725	8.27e-16	SMART
low complexity region	740	748	N/A	INTRINSIC
C2	790	897	4.08e-21	SMART
low complexity region	905	919	N/A	INTRINSIC
low complexity region	1085	1101	N/A	INTRINSIC
low complexity region	1116	1130	N/A	INTRINSIC
low complexity region	1208	1238	N/A	INTRINSIC
C2	1432	1535	3.78e-16	SMART

Predicted Effect

possibly damaging
Transcript: ENSMUST00000082054
AA Change: S56P

PolyPhen 2 Score 0.777 (Sensitivity: 0.85; Specificity: 0.92)

SMART Domains

Protein: ENSMUSP00000080711
Gene: ENSMUSG00000037386
AA Change: S56P

Domain	Start	End	E-Value	Type
low complexity region	3	24	N/A	INTRINSIC
Pfam:FYVE_2	76	194	2.2e-11	PFAM
low complexity region	355	375	N/A	INTRINSIC
low complexity region	532	538	N/A	INTRINSIC
low complexity region	551	561	N/A	INTRINSIC
low complexity region	567	580	N/A	INTRINSIC
PDZ	686	765	8.27e-16	SMART
low complexity region	780	788	N/A	INTRINSIC
C2	830	937	4.08e-21	SMART
low complexity region	945	959	N/A	INTRINSIC
low complexity region	1075	1086	N/A	INTRINSIC
low complexity region	1166	1196	N/A	INTRINSIC
C2	1390	1493	3.78e-16	SMART

Predicted Effect

possibly damaging
Transcript: ENSMUST00000227243
AA Change: S56P

PolyPhen 2 Score 0.650 (Sensitivity: 0.87; Specificity: 0.91)

Coding Region Coverage

1x: 100.0%
3x: 99.9%
10x: 99.7%
20x: 98.9%

Validation Efficiency

100% (97/97)

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene is a presynaptic protein that interacts with RAB3, a protein important for normal neurotransmitter release. The encoded protein can also bind several other synaptic proteins, including UNC-13 homolog B, ELKS/Rab6-interacting/CAST family member 1, and synaptotagmin 1. This protein is involved in synaptic membrane exocytosis. Polymorphisms in this gene have been associated with degenerative lumbar scoliosis. [provided by RefSeq, Feb 2017]
PHENOTYPE: Mice homozygous for a knock-out allele show reduced body size, aberrant insulin granule exocytosis, and impaired secretion of hormones associated with glucose homeostasis. Mice homozygous for another knock-out allele show a slightly reduced body size, abnormal maternal behavior and premature death. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 99 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
3110002H16Rik	G	A	18: 12,181,599	D289N	probably damaging	Het
Aars	G	T	8: 111,043,264	V332F	possibly damaging	Het
Abhd15	T	A	11: 77,518,734	S425T	probably benign	Het
Acads	A	T	5: 115,112,781	F152L	probably damaging	Het
Acpp	T	A	9: 104,326,966	H43L	probably damaging	Het
Adora2a	A	G	10: 75,333,646	S315G	probably benign	Het
Agxt2	A	T	15: 10,381,386	D242V	probably damaging	Het
Alx4	A	G	2: 93,642,711	D18G	probably damaging	Het
Ankrd11	A	G	8: 122,884,231	S2639P	probably damaging	Het
Arhgap35	A	T	7: 16,561,528	V1204D	possibly damaging	Het
Arid2	A	G	15: 96,369,375	T579A	probably benign	Het
B4galt1	C	T	4: 40,809,373	G332S	probably benign	Het
B4galt4	C	A	16: 38,757,810	Y206*	probably null	Het
Bcl2l14	A	T	6: 134,432,314	T284S	possibly damaging	Het
Bop1	C	T	15: 76,454,348	V465M	probably damaging	Het
Cacna1b	A	T	2: 24,677,965	L1037H	probably damaging	Het
Cadm2	G	A	16: 66,771,637	T254M	probably benign	Het
Ccdc180	T	C	4: 45,890,389		probably null	Het
Ccdc7a	A	T	8: 128,892,437	D875E	possibly damaging	Het
Cenpu	A	G	8: 46,562,467	D139G	possibly damaging	Het
Cep57l1	A	T	10: 41,722,940	C292*	probably null	Het
Cep89	G	A	7: 35,429,928	R630H	probably damaging	Het
Chst14	A	G	2: 118,927,775	H350R	probably benign	Het
Clca3a1	T	A	3: 144,749,731	I434F	possibly damaging	Het
Crispld2	A	G	8: 120,031,070	T385A	probably benign	Het
Crmp1	A	C	5: 37,284,095	N507T	probably damaging	Het
Cyp4f40	T	A	17: 32,671,169	I271N	probably damaging	Het
D630003M21Rik	G	T	2: 158,210,162	Q670K	possibly damaging	Het
Ddx42	T	C	11: 106,236,996	I342T	probably damaging	Het
Dnah9	T	A	11: 65,850,013	I4116F	probably damaging	Het
Ehd2	T	C	7: 15,950,758	H372R	probably benign	Het
Gja8	C	A	3: 96,919,776	C190F	probably damaging	Het
Gm13088	A	G	4: 143,654,553	L300P	probably benign	Het
Gm8297	A	T	14: 4,984,945	D72V	possibly damaging	Het
Golgb1	A	G	16: 36,918,730	D2518G	probably benign	Het
Hsd17b12	C	A	2: 94,033,641	M285I	probably benign	Het
Hus1	T	C	11: 9,000,133	E196G	probably damaging	Het
Irf2	G	A	8: 46,807,279	R82Q	probably damaging	Het
Irx2	A	G	13: 72,631,374	D259G	possibly damaging	Het
Jph1	T	A	1: 17,004,378	Q472L	probably benign	Het
Kif2a	T	C	13: 106,987,982	Q142R	probably benign	Het
Lonp1	T	C	17: 56,622,515	Y174C	probably damaging	Het
Mapk14	T	C	17: 28,746,297	F348L	probably damaging	Het
March10	G	T	11: 105,390,228	D410E	probably benign	Het
Mff	A	T	1: 82,747,081		probably null	Het
Necab3	G	A	2: 154,546,280	R271C	probably damaging	Het
Nlrp4e	T	A	7: 23,321,757	F556L	possibly damaging	Het
Nt5c2	T	C	19: 46,889,946	K425E	probably benign	Het
Ofcc1	A	T	13: 40,142,826	W511R	probably damaging	Het
Olfr1283	T	C	2: 111,369,403	I257T	probably benign	Het
Olfr347	A	C	2: 36,734,330	E3A	probably benign	Het
Olfr551	T	A	7: 102,588,883		probably benign	Het
Olfr56	T	A	11: 49,134,669	I159N	possibly damaging	Het
P2rx2	G	C	5: 110,340,344	A448G	possibly damaging	Het
Papd5	A	T	8: 88,252,554	Q561L	probably benign	Het
Pcnx2	A	T	8: 125,892,018	N56K	possibly damaging	Het
Pdzd7	A	C	19: 45,040,218	M162R	possibly damaging	Het
Phyhd1	A	G	2: 30,266,770	M1V	probably null	Het
Pla2g16	T	C	19: 7,579,295	C154R	probably benign	Het
Plekha5	A	G	6: 140,589,224	E1126G	possibly damaging	Het
Plekhm1	A	T	11: 103,397,060	V87D	probably damaging	Het
Pole	G	A	5: 110,297,466		probably null	Het
R3hcc1	T	C	14: 69,705,508	M207V	probably benign	Het
R3hcc1l	T	A	19: 42,563,964	S467T	probably damaging	Het
Rasgrp4	G	T	7: 29,143,102	R267L	probably damaging	Het
Rbm20	T	C	19: 53,850,136	I848T	probably benign	Het
Sacs	T	A	14: 61,209,773	D3089E	probably benign	Het
Sall2	C	T	14: 52,316,064	G16R	probably damaging	Het
Scgb1b19	G	A	7: 33,288,487	C93Y	probably damaging	Het
Scn3a	T	A	2: 65,466,990	K1442*	probably null	Het
Sepsecs	A	G	5: 52,644,049	S424P	probably damaging	Het
Set	G	T	2: 30,070,311	V219F	probably benign	Het
Sh3tc1	A	T	5: 35,710,951	F390I	probably damaging	Het
Simc1	G	A	13: 54,547,330	V1269M	probably damaging	Het
Ska3	T	G	14: 57,810,055	D341A	probably damaging	Het
Skiv2l2	A	T	13: 112,872,909	D985E	probably benign	Het
Slc16a10	A	T	10: 40,037,415		probably null	Het
Srgap1	T	A	10: 121,925,967	N92I	probably damaging	Het
Sspo	T	C	6: 48,454,690	V639A	probably damaging	Het
Stk11	A	T	10: 80,125,437		probably benign	Het
Sult5a1	G	A	8: 123,145,441	H221Y	probably benign	Het
Sytl3	T	A	17: 6,736,578	M559K	probably benign	Het
Tab2	A	C	10: 7,919,133	D528E	possibly damaging	Het
Tbc1d15	A	G	10: 115,221,587	I218T	possibly damaging	Het
Tenm4	T	A	7: 96,774,014	M672K	possibly damaging	Het
Tfrc	A	G	16: 32,619,167	K346R	probably benign	Het
Thsd1	G	T	8: 22,243,098	G54W	probably damaging	Het
Tmprss15	A	T	16: 79,003,387	L618I	probably damaging	Het
Top3a	T	C	11: 60,742,964	S769G	probably benign	Het
Trp63	C	A	16: 25,868,224	P396Q	possibly damaging	Het
Ttc30a2	T	C	2: 75,976,929	N413S	probably benign	Het
Uggt1	T	C	1: 36,207,984	S311G	probably damaging	Het
Usp10	G	A	8: 119,952,001	E574K	possibly damaging	Het
Wfdc6b	T	A	2: 164,617,902	I148K	probably damaging	Het
Zcchc2	T	G	1: 106,018,252	I474R	probably damaging	Het
Zdhhc2	A	G	8: 40,447,141	K82R	probably benign	Het
Zfp273	A	G	13: 67,826,016	D421G	possibly damaging	Het
Zfp280d	T	C	9: 72,331,319	I639T	probably damaging	Het
Zfp429	A	T	13: 67,390,439	C295*	probably null	Het

Other mutations in Rims2

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00339:Rims2	APN	15	39459615	missense	probably benign	0.11
IGL00502:Rims2	APN	15	39506984	missense	probably damaging	1.00
IGL00556:Rims2	APN	15	39456674	splice site	probably null
IGL00811:Rims2	APN	15	39292149	missense	probably damaging	1.00
IGL00827:Rims2	APN	15	39472359	missense	probably damaging	0.99
IGL01642:Rims2	APN	15	39457796	missense	probably damaging	1.00
IGL02951:Rims2	APN	15	39534938	missense	probably damaging	1.00
IGL03009:Rims2	APN	15	39566997	missense	possibly damaging	0.85
IGL03080:Rims2	APN	15	39535903	missense	probably damaging	1.00
IGL03102:Rims2	APN	15	39459593	missense	possibly damaging	0.95
IGL03252:Rims2	APN	15	39452352	missense	probably benign
IGL03365:Rims2	APN	15	39476541	missense	probably damaging	1.00
IGL03393:Rims2	APN	15	39462613	splice site	probably null
IGL03409:Rims2	APN	15	39456733	missense	probably damaging	1.00
rhyme	UTSW	15	39452328	missense	probably damaging	1.00
PIT4486001:Rims2	UTSW	15	39476520	missense	possibly damaging	0.67
R0009:Rims2	UTSW	15	39534966	missense	probably damaging	0.99
R0009:Rims2	UTSW	15	39534966	missense	probably damaging	0.99
R0078:Rims2	UTSW	15	39534855	missense	probably benign	0.42
R0367:Rims2	UTSW	15	39462615	splice site	probably null
R0401:Rims2	UTSW	15	39509632	splice site	probably benign
R0531:Rims2	UTSW	15	39567030	missense	probably damaging	1.00
R0791:Rims2	UTSW	15	39679625	splice site	probably benign
R0838:Rims2	UTSW	15	39681025	missense	probably benign	0.02
R1201:Rims2	UTSW	15	39616324	missense	possibly damaging	0.91
R1318:Rims2	UTSW	15	39517826	missense	probably damaging	0.99
R1457:Rims2	UTSW	15	39511314	missense	possibly damaging	0.63
R1619:Rims2	UTSW	15	39506986	missense	probably damaging	1.00
R1672:Rims2	UTSW	15	39292189	missense	probably benign	0.09
R1743:Rims2	UTSW	15	39679650	missense	probably benign	0.10
R1766:Rims2	UTSW	15	39462580	missense	probably damaging	0.99
R1779:Rims2	UTSW	15	39681702	missense	probably damaging	1.00
R1804:Rims2	UTSW	15	39437043	nonsense	probably null
R1985:Rims2	UTSW	15	39345314	missense	probably damaging	0.99
R1986:Rims2	UTSW	15	39345314	missense	probably damaging	0.99
R2113:Rims2	UTSW	15	39511326	missense	probably benign	0.17
R2260:Rims2	UTSW	15	39478566	nonsense	probably null
R2510:Rims2	UTSW	15	39585652	missense	probably damaging	1.00
R3693:Rims2	UTSW	15	39478575	missense	probably benign	0.01
R3937:Rims2	UTSW	15	39437845	missense	probably damaging	1.00
R4425:Rims2	UTSW	15	39437924	critical splice donor site	probably null
R4453:Rims2	UTSW	15	39292208	missense	probably damaging	1.00
R4474:Rims2	UTSW	15	39462560	missense	probably damaging	1.00
R4518:Rims2	UTSW	15	39437526	missense	probably damaging	1.00
R4526:Rims2	UTSW	15	39437717	missense	probably damaging	1.00
R4833:Rims2	UTSW	15	39535914	missense	probably damaging	0.98
R4936:Rims2	UTSW	15	39437728	missense	probably damaging	1.00
R4993:Rims2	UTSW	15	39454445	missense	possibly damaging	0.90
R5001:Rims2	UTSW	15	39452428	missense	probably benign	0.03
R5054:Rims2	UTSW	15	39517869	splice site	probably null
R5072:Rims2	UTSW	15	39462590	missense	probably benign	0.01
R5171:Rims2	UTSW	15	39437103	missense	probably damaging	1.00
R5429:Rims2	UTSW	15	39345355	missense	probably damaging	1.00
R5623:Rims2	UTSW	15	39478615	missense	probably damaging	1.00
R5624:Rims2	UTSW	15	39345413	missense	possibly damaging	0.46
R5685:Rims2	UTSW	15	39437206	missense	possibly damaging	0.67
R5784:Rims2	UTSW	15	39535987	splice site	probably null
R5790:Rims2	UTSW	15	39681045	missense	probably damaging	1.00
R5822:Rims2	UTSW	15	39476490	missense	probably damaging	1.00
R5963:Rims2	UTSW	15	39437182	missense	probably damaging	1.00
R5988:Rims2	UTSW	15	39292182	missense	probably damaging	1.00
R6057:Rims2	UTSW	15	39675020	missense	probably damaging	1.00
R6239:Rims2	UTSW	15	39198363	start codon destroyed	unknown
R6407:Rims2	UTSW	15	39452328	missense	probably damaging	1.00
R6418:Rims2	UTSW	15	39509696	missense	probably damaging	1.00
R6495:Rims2	UTSW	15	39517812	missense	probably benign	0.01
R6502:Rims2	UTSW	15	39534855	missense	probably benign	0.42
R6753:Rims2	UTSW	15	39566973	missense	possibly damaging	0.74
R6855:Rims2	UTSW	15	39345515	missense	probably benign	0.06
R6948:Rims2	UTSW	15	39511341	missense	probably benign
R7058:Rims2	UTSW	15	39585648	missense	probably damaging	1.00
R7167:Rims2	UTSW	15	39437077	missense	probably benign
R7217:Rims2	UTSW	15	39476489	missense	probably damaging	0.99
R7223:Rims2	UTSW	15	39437032	missense	probably benign	0.30
R7289:Rims2	UTSW	15	39437718	missense	probably benign	0.00
R7459:Rims2	UTSW	15	39517839	missense	probably benign
R7663:Rims2	UTSW	15	39507026	missense	probably damaging	1.00
R7836:Rims2	UTSW	15	39681079	missense	probably damaging	1.00
R8082:Rims2	UTSW	15	39476523	missense	probably benign	0.34
R8489:Rims2	UTSW	15	39616450	missense	probably damaging	1.00
R8730:Rims2	UTSW	15	39517843	missense	probably benign	0.01
R8830:Rims2	UTSW	15	39437362	missense	possibly damaging	0.64
R8857:Rims2	UTSW	15	39679648	missense	possibly damaging	0.95
R8893:Rims2	UTSW	15	39534954	missense	probably benign	0.02
R9010:Rims2	UTSW	15	39452390	nonsense	probably null
R9030:Rims2	UTSW	15	39476477	missense	probably damaging	1.00
R9287:Rims2	UTSW	15	39679690	missense	probably damaging	1.00
R9395:Rims2	UTSW	15	39292269	missense	probably damaging	1.00
R9451:Rims2	UTSW	15	39437328	missense	probably damaging	1.00
X0034:Rims2	UTSW	15	39437534	missense	probably benign
Z1177:Rims2	UTSW	15	39437769	missense	probably benign	0.24
Z1177:Rims2	UTSW	15	39478690	frame shift	probably null
Z1177:Rims2	UTSW	15	39681114	missense	probably damaging	1.00

Predicted Primers

PCR Primer
(F):5'- TGTATGCATTTGTCCCAGCC -3'
(R):5'- GACAACTAGAAAGCGACCCTGG -3'

Sequencing Primer
(F):5'- ATTTGTCCCAGCCCCGGAG -3'
(R):5'- AGGAAAGGCGGCGATCCCC -3'

Posted On

2019-11-26