Incidental Mutation 'R7792:Bop1'
ID599985
Institutional Source Beutler Lab
Gene Symbol Bop1
Ensembl Gene ENSMUSG00000022557
Gene Nameblock of proliferation 1
SynonymsErb1p
Accession Numbers
Is this an essential gene? Probably essential (E-score: 0.931) question?
Stock #R7792 (G1)
Quality Score225.009
Status Validated
Chromosome15
Chromosomal Location76452989-76477277 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) C to T at 76454348 bp
ZygosityHeterozygous
Amino Acid Change Valine to Methionine at position 465 (V465M)
Ref Sequence ENSEMBL: ENSMUSP00000023217 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000023217] [ENSMUST00000043089] [ENSMUST00000096385]
Predicted Effect probably damaging
Transcript: ENSMUST00000023217
AA Change: V465M

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000023217
Gene: ENSMUSG00000022557
AA Change: V465M

DomainStartEndE-ValueType
low complexity region 31 48 N/A INTRINSIC
low complexity region 106 117 N/A INTRINSIC
BOP1NT 130 388 1.38e-177 SMART
WD40 388 427 1.16e-9 SMART
WD40 430 469 6.16e0 SMART
WD40 508 551 7.1e1 SMART
WD40 554 592 4.46e-1 SMART
WD40 595 634 2.76e-2 SMART
WD40 638 677 4.14e-6 SMART
WD40 689 732 3.14e-6 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000043089
SMART Domains Protein: ENSMUSP00000043668
Gene: ENSMUSG00000034161

DomainStartEndE-ValueType
low complexity region 24 38 N/A INTRINSIC
low complexity region 45 80 N/A INTRINSIC
HLH 84 136 1.46e-16 SMART
low complexity region 161 171 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000096385
SMART Domains Protein: ENSMUSP00000094115
Gene: ENSMUSG00000022558

DomainStartEndE-ValueType
low complexity region 442 455 N/A INTRINSIC
low complexity region 594 607 N/A INTRINSIC
low complexity region 799 810 N/A INTRINSIC
low complexity region 935 946 N/A INTRINSIC
low complexity region 1191 1202 N/A INTRINSIC
low complexity region 1355 1367 N/A INTRINSIC
low complexity region 1488 1502 N/A INTRINSIC
Pfam:HEAT 1610 1640 2.2e-5 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000161265
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.7%
  • 20x: 98.9%
Validation Efficiency 100% (97/97)
Allele List at MGI
Other mutations in this stock
Total: 99 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
3110002H16Rik G A 18: 12,181,599 D289N probably damaging Het
Aars G T 8: 111,043,264 V332F possibly damaging Het
Abhd15 T A 11: 77,518,734 S425T probably benign Het
Acads A T 5: 115,112,781 F152L probably damaging Het
Acpp T A 9: 104,326,966 H43L probably damaging Het
Adora2a A G 10: 75,333,646 S315G probably benign Het
Agxt2 A T 15: 10,381,386 D242V probably damaging Het
Alx4 A G 2: 93,642,711 D18G probably damaging Het
Ankrd11 A G 8: 122,884,231 S2639P probably damaging Het
Arhgap35 A T 7: 16,561,528 V1204D possibly damaging Het
Arid2 A G 15: 96,369,375 T579A probably benign Het
B4galt1 C T 4: 40,809,373 G332S probably benign Het
B4galt4 C A 16: 38,757,810 Y206* probably null Het
Bcl2l14 A T 6: 134,432,314 T284S possibly damaging Het
Cacna1b A T 2: 24,677,965 L1037H probably damaging Het
Cadm2 G A 16: 66,771,637 T254M probably benign Het
Ccdc180 T C 4: 45,890,389 probably null Het
Ccdc7a A T 8: 128,892,437 D875E possibly damaging Het
Cenpu A G 8: 46,562,467 D139G possibly damaging Het
Cep57l1 A T 10: 41,722,940 C292* probably null Het
Cep89 G A 7: 35,429,928 R630H probably damaging Het
Chst14 A G 2: 118,927,775 H350R probably benign Het
Clca3a1 T A 3: 144,749,731 I434F possibly damaging Het
Crispld2 A G 8: 120,031,070 T385A probably benign Het
Crmp1 A C 5: 37,284,095 N507T probably damaging Het
Cyp4f40 T A 17: 32,671,169 I271N probably damaging Het
D630003M21Rik G T 2: 158,210,162 Q670K possibly damaging Het
Ddx42 T C 11: 106,236,996 I342T probably damaging Het
Dnah9 T A 11: 65,850,013 I4116F probably damaging Het
Ehd2 T C 7: 15,950,758 H372R probably benign Het
Gja8 C A 3: 96,919,776 C190F probably damaging Het
Gm13088 A G 4: 143,654,553 L300P probably benign Het
Gm8297 A T 14: 4,984,945 D72V possibly damaging Het
Golgb1 A G 16: 36,918,730 D2518G probably benign Het
Hsd17b12 C A 2: 94,033,641 M285I probably benign Het
Hus1 T C 11: 9,000,133 E196G probably damaging Het
Irf2 G A 8: 46,807,279 R82Q probably damaging Het
Irx2 A G 13: 72,631,374 D259G possibly damaging Het
Jph1 T A 1: 17,004,378 Q472L probably benign Het
Kif2a T C 13: 106,987,982 Q142R probably benign Het
Lonp1 T C 17: 56,622,515 Y174C probably damaging Het
Mapk14 T C 17: 28,746,297 F348L probably damaging Het
March10 G T 11: 105,390,228 D410E probably benign Het
Mff A T 1: 82,747,081 probably null Het
Necab3 G A 2: 154,546,280 R271C probably damaging Het
Nlrp4e T A 7: 23,321,757 F556L possibly damaging Het
Nt5c2 T C 19: 46,889,946 K425E probably benign Het
Ofcc1 A T 13: 40,142,826 W511R probably damaging Het
Olfr1283 T C 2: 111,369,403 I257T probably benign Het
Olfr347 A C 2: 36,734,330 E3A probably benign Het
Olfr551 T A 7: 102,588,883 probably benign Het
Olfr56 T A 11: 49,134,669 I159N possibly damaging Het
P2rx2 G C 5: 110,340,344 A448G possibly damaging Het
Papd5 A T 8: 88,252,554 Q561L probably benign Het
Pcnx2 A T 8: 125,892,018 N56K possibly damaging Het
Pdzd7 A C 19: 45,040,218 M162R possibly damaging Het
Phyhd1 A G 2: 30,266,770 M1V probably null Het
Pla2g16 T C 19: 7,579,295 C154R probably benign Het
Plekha5 A G 6: 140,589,224 E1126G possibly damaging Het
Plekhm1 A T 11: 103,397,060 V87D probably damaging Het
Pole G A 5: 110,297,466 probably null Het
R3hcc1 T C 14: 69,705,508 M207V probably benign Het
R3hcc1l T A 19: 42,563,964 S467T probably damaging Het
Rasgrp4 G T 7: 29,143,102 R267L probably damaging Het
Rbm20 T C 19: 53,850,136 I848T probably benign Het
Rims2 T C 15: 39,198,528 S56P possibly damaging Het
Sacs T A 14: 61,209,773 D3089E probably benign Het
Sall2 C T 14: 52,316,064 G16R probably damaging Het
Scgb1b19 G A 7: 33,288,487 C93Y probably damaging Het
Scn3a T A 2: 65,466,990 K1442* probably null Het
Sepsecs A G 5: 52,644,049 S424P probably damaging Het
Set G T 2: 30,070,311 V219F probably benign Het
Sh3tc1 A T 5: 35,710,951 F390I probably damaging Het
Simc1 G A 13: 54,547,330 V1269M probably damaging Het
Ska3 T G 14: 57,810,055 D341A probably damaging Het
Skiv2l2 A T 13: 112,872,909 D985E probably benign Het
Slc16a10 A T 10: 40,037,415 probably null Het
Srgap1 T A 10: 121,925,967 N92I probably damaging Het
Sspo T C 6: 48,454,690 V639A probably damaging Het
Stk11 A T 10: 80,125,437 probably benign Het
Sult5a1 G A 8: 123,145,441 H221Y probably benign Het
Sytl3 T A 17: 6,736,578 M559K probably benign Het
Tab2 A C 10: 7,919,133 D528E possibly damaging Het
Tbc1d15 A G 10: 115,221,587 I218T possibly damaging Het
Tenm4 T A 7: 96,774,014 M672K possibly damaging Het
Tfrc A G 16: 32,619,167 K346R probably benign Het
Thsd1 G T 8: 22,243,098 G54W probably damaging Het
Tmprss15 A T 16: 79,003,387 L618I probably damaging Het
Top3a T C 11: 60,742,964 S769G probably benign Het
Trp63 C A 16: 25,868,224 P396Q possibly damaging Het
Ttc30a2 T C 2: 75,976,929 N413S probably benign Het
Uggt1 T C 1: 36,207,984 S311G probably damaging Het
Usp10 G A 8: 119,952,001 E574K possibly damaging Het
Wfdc6b T A 2: 164,617,902 I148K probably damaging Het
Zcchc2 T G 1: 106,018,252 I474R probably damaging Het
Zdhhc2 A G 8: 40,447,141 K82R probably benign Het
Zfp273 A G 13: 67,826,016 D421G possibly damaging Het
Zfp280d T C 9: 72,331,319 I639T probably damaging Het
Zfp429 A T 13: 67,390,439 C295* probably null Het
Other mutations in Bop1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00436:Bop1 APN 15 76454528 missense probably benign 0.04
IGL01085:Bop1 APN 15 76453376 missense probably damaging 1.00
IGL02157:Bop1 APN 15 76455572 missense possibly damaging 0.70
R0332:Bop1 UTSW 15 76455987 missense probably damaging 1.00
R2148:Bop1 UTSW 15 76455287 missense probably damaging 0.96
R3979:Bop1 UTSW 15 76453876 missense probably damaging 1.00
R4133:Bop1 UTSW 15 76454335 missense probably benign 0.24
R5396:Bop1 UTSW 15 76455289 missense probably damaging 1.00
R5434:Bop1 UTSW 15 76455411 missense probably benign 0.01
R5666:Bop1 UTSW 15 76454233 missense probably benign 0.00
R5820:Bop1 UTSW 15 76454841 missense probably damaging 1.00
R5883:Bop1 UTSW 15 76454849 missense probably damaging 1.00
R5907:Bop1 UTSW 15 76455917 missense probably damaging 1.00
R6807:Bop1 UTSW 15 76454983 missense probably damaging 0.99
R6947:Bop1 UTSW 15 76453988 missense probably damaging 1.00
R7232:Bop1 UTSW 15 76453346 missense probably damaging 1.00
R7395:Bop1 UTSW 15 76453841 missense probably damaging 1.00
R7477:Bop1 UTSW 15 76455326 missense probably damaging 1.00
R7725:Bop1 UTSW 15 76455383 missense probably benign 0.23
Predicted Primers PCR Primer
(F):5'- CCATCACATACTTTGCTGTGGC -3'
(R):5'- ATGGCACGTTGAAGCTCTGG -3'

Sequencing Primer
(F):5'- CTGTGGCAGATGCGTAGGC -3'
(R):5'- CCCGCTGTATGAAGACTGTACATG -3'
Posted On2019-11-26