Incidental Mutation 'R7792:Cadm2'
ID 599991
Institutional Source Beutler Lab
Gene Symbol Cadm2
Ensembl Gene ENSMUSG00000064115
Gene Name cell adhesion molecule 2
Synonyms SynCAM2, Necl3, A830029E02Rik, Igsf4d, 2900078E11Rik
MMRRC Submission 045848-MU
Accession Numbers
Essential gene? Possibly non essential (E-score: 0.463) question?
Stock # R7792 (G1)
Quality Score 225.009
Status Validated
Chromosome 16
Chromosomal Location 66452307-67417796 bp(-) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) G to A at 66568523 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Threonine to Methionine at position 254 (T254M)
Ref Sequence ENSEMBL: ENSMUSP00000109931 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000114292] [ENSMUST00000120594] [ENSMUST00000120898] [ENSMUST00000128168]
AlphaFold Q8BLQ9
PDB Structure Crystal structure of Ig1 domain of mouse SynCAM 2 [X-RAY DIFFRACTION]
Predicted Effect probably benign
Transcript: ENSMUST00000114292
AA Change: T254M

PolyPhen 2 Score 0.009 (Sensitivity: 0.96; Specificity: 0.77)
SMART Domains Protein: ENSMUSP00000109931
Gene: ENSMUSG00000064115
AA Change: T254M

DomainStartEndE-ValueType
signal peptide 1 24 N/A INTRINSIC
IG 38 130 2.19e-9 SMART
Pfam:Ig_3 135 216 1.2e-6 PFAM
Pfam:C2-set_2 135 222 6.4e-17 PFAM
Pfam:Ig_2 135 228 1.8e-6 PFAM
Pfam:I-set 136 229 1.3e-7 PFAM
Pfam:C1-set 142 225 1.5e-9 PFAM
IGc2 248 312 2.56e-10 SMART
4.1m 357 375 5.39e-5 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000120594
AA Change: T245M

PolyPhen 2 Score 0.120 (Sensitivity: 0.93; Specificity: 0.86)
SMART Domains Protein: ENSMUSP00000113500
Gene: ENSMUSG00000064115
AA Change: T245M

DomainStartEndE-ValueType
IG 29 121 2.19e-9 SMART
Pfam:Ig_3 126 207 4.2e-7 PFAM
Pfam:C2-set_2 126 213 1.8e-16 PFAM
Pfam:I-set 127 220 1.5e-7 PFAM
Pfam:C1-set 133 216 7e-10 PFAM
Pfam:ig 133 218 9.5e-9 PFAM
IGc2 239 303 2.56e-10 SMART
low complexity region 319 352 N/A INTRINSIC
4.1m 388 406 5.39e-5 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000120898
AA Change: T245M

PolyPhen 2 Score 0.009 (Sensitivity: 0.96; Specificity: 0.77)
SMART Domains Protein: ENSMUSP00000113178
Gene: ENSMUSG00000064115
AA Change: T245M

DomainStartEndE-ValueType
IG 29 121 2.19e-9 SMART
Pfam:Ig_3 126 207 1.2e-6 PFAM
Pfam:C2-set_2 126 213 6.2e-17 PFAM
Pfam:Ig_2 126 219 1.7e-6 PFAM
Pfam:I-set 127 220 1.3e-7 PFAM
Pfam:C1-set 133 216 1.5e-9 PFAM
IGc2 239 303 2.56e-10 SMART
4.1m 348 366 5.39e-5 SMART
Predicted Effect possibly damaging
Transcript: ENSMUST00000128168
AA Change: T245M

PolyPhen 2 Score 0.804 (Sensitivity: 0.84; Specificity: 0.93)
SMART Domains Protein: ENSMUSP00000134554
Gene: ENSMUSG00000064115
AA Change: T245M

DomainStartEndE-ValueType
IG 29 121 2.19e-9 SMART
Pfam:Ig_3 126 207 1.4e-6 PFAM
Pfam:C2-set_2 126 213 7.2e-16 PFAM
Pfam:I-set 127 220 5e-7 PFAM
Pfam:C1-set 133 216 2.2e-9 PFAM
Pfam:ig 133 218 3.6e-8 PFAM
IGc2 239 303 2.56e-10 SMART
low complexity region 319 352 N/A INTRINSIC
4.1m 388 406 5.39e-5 SMART
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.7%
  • 20x: 98.9%
Validation Efficiency 100% (97/97)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of the synaptic cell adhesion molecule 1 (SynCAM) family which belongs to the immunoglobulin (Ig) superfamily. The encoded protein has three Ig-like domains and a cytosolic protein 4.1 binding site near the C-terminus. Proteins belonging to the protein 4.1 family crosslink spectrin and interact with other cytoskeletal proteins. Multiple transcript variants encoding different isoforms have been found for this gene. [provided by RefSeq, Feb 2012]
PHENOTYPE: Mice with ubiquitous conditional deletion of the gene do not display any neurological abnormalities. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 99 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Aars1 G T 8: 111,769,896 (GRCm39) V332F possibly damaging Het
Abhd15 T A 11: 77,409,560 (GRCm39) S425T probably benign Het
Acads A T 5: 115,250,840 (GRCm39) F152L probably damaging Het
Acp3 T A 9: 104,204,165 (GRCm39) H43L probably damaging Het
Adora2a A G 10: 75,169,480 (GRCm39) S315G probably benign Het
Agxt2 A T 15: 10,381,472 (GRCm39) D242V probably damaging Het
Alx4 A G 2: 93,473,056 (GRCm39) D18G probably damaging Het
Ankrd11 A G 8: 123,610,970 (GRCm39) S2639P probably damaging Het
Arhgap35 A T 7: 16,295,453 (GRCm39) V1204D possibly damaging Het
Arid2 A G 15: 96,267,256 (GRCm39) T579A probably benign Het
B4galt1 C T 4: 40,809,373 (GRCm39) G332S probably benign Het
B4galt4 C A 16: 38,578,172 (GRCm39) Y206* probably null Het
Bcl2l14 A T 6: 134,409,277 (GRCm39) T284S possibly damaging Het
Bop1 C T 15: 76,338,548 (GRCm39) V465M probably damaging Het
Cacna1b A T 2: 24,567,977 (GRCm39) L1037H probably damaging Het
Ccdc180 T C 4: 45,890,389 (GRCm39) probably null Het
Ccdc7a A T 8: 129,618,918 (GRCm39) D875E possibly damaging Het
Cenpu A G 8: 47,015,502 (GRCm39) D139G possibly damaging Het
Cep57l1 A T 10: 41,598,936 (GRCm39) C292* probably null Het
Cep89 G A 7: 35,129,353 (GRCm39) R630H probably damaging Het
Chst14 A G 2: 118,758,256 (GRCm39) H350R probably benign Het
Clca3a1 T A 3: 144,455,492 (GRCm39) I434F possibly damaging Het
Crispld2 A G 8: 120,757,809 (GRCm39) T385A probably benign Het
Crmp1 A C 5: 37,441,439 (GRCm39) N507T probably damaging Het
Cyp4f40 T A 17: 32,890,143 (GRCm39) I271N probably damaging Het
D630003M21Rik G T 2: 158,052,082 (GRCm39) Q670K possibly damaging Het
Ddx42 T C 11: 106,127,822 (GRCm39) I342T probably damaging Het
Dnah9 T A 11: 65,740,839 (GRCm39) I4116F probably damaging Het
Ehd2 T C 7: 15,684,683 (GRCm39) H372R probably benign Het
Gja8 C A 3: 96,827,092 (GRCm39) C190F probably damaging Het
Gm8297 A T 14: 16,165,939 (GRCm39) D72V possibly damaging Het
Golgb1 A G 16: 36,739,092 (GRCm39) D2518G probably benign Het
Hsd17b12 C A 2: 93,863,986 (GRCm39) M285I probably benign Het
Hus1 T C 11: 8,950,133 (GRCm39) E196G probably damaging Het
Ift70a2 T C 2: 75,807,273 (GRCm39) N413S probably benign Het
Irf2 G A 8: 47,260,314 (GRCm39) R82Q probably damaging Het
Irx2 A G 13: 72,779,493 (GRCm39) D259G possibly damaging Het
Jph1 T A 1: 17,074,602 (GRCm39) Q472L probably benign Het
Kif2a T C 13: 107,124,490 (GRCm39) Q142R probably benign Het
Lonp1 T C 17: 56,929,515 (GRCm39) Y174C probably damaging Het
Mapk14 T C 17: 28,965,271 (GRCm39) F348L probably damaging Het
Marchf10 G T 11: 105,281,054 (GRCm39) D410E probably benign Het
Mff A T 1: 82,724,802 (GRCm39) probably null Het
Mtrex A T 13: 113,009,443 (GRCm39) D985E probably benign Het
Necab3 G A 2: 154,388,200 (GRCm39) R271C probably damaging Het
Nlrp4e T A 7: 23,021,182 (GRCm39) F556L possibly damaging Het
Nt5c2 T C 19: 46,878,385 (GRCm39) K425E probably benign Het
Ofcc1 A T 13: 40,296,302 (GRCm39) W511R probably damaging Het
Or1j18 A C 2: 36,624,342 (GRCm39) E3A probably benign Het
Or2v1 T A 11: 49,025,496 (GRCm39) I159N possibly damaging Het
Or4k77 T C 2: 111,199,748 (GRCm39) I257T probably benign Het
Or52p2 T A 7: 102,238,090 (GRCm39) probably benign Het
P2rx2 G C 5: 110,488,210 (GRCm39) A448G possibly damaging Het
Pcnx2 A T 8: 126,618,757 (GRCm39) N56K possibly damaging Het
Pdzd7 A C 19: 45,028,657 (GRCm39) M162R possibly damaging Het
Phyhd1 A G 2: 30,156,782 (GRCm39) M1V probably null Het
Plaat3 T C 19: 7,556,660 (GRCm39) C154R probably benign Het
Plekha5 A G 6: 140,534,950 (GRCm39) E1126G possibly damaging Het
Plekhm1 A T 11: 103,287,886 (GRCm39) V87D probably damaging Het
Pole G A 5: 110,445,332 (GRCm39) probably null Het
Pramel22 A G 4: 143,381,123 (GRCm39) L300P probably benign Het
R3hcc1 T C 14: 69,942,957 (GRCm39) M207V probably benign Het
R3hcc1l T A 19: 42,552,403 (GRCm39) S467T probably damaging Het
Rasgrp4 G T 7: 28,842,527 (GRCm39) R267L probably damaging Het
Rbm20 T C 19: 53,838,567 (GRCm39) I848T probably benign Het
Rims2 T C 15: 39,061,923 (GRCm39) S56P possibly damaging Het
Rmc1 G A 18: 12,314,656 (GRCm39) D289N probably damaging Het
Sacs T A 14: 61,447,222 (GRCm39) D3089E probably benign Het
Sall2 C T 14: 52,553,521 (GRCm39) G16R probably damaging Het
Scgb1b19 G A 7: 32,987,912 (GRCm39) C93Y probably damaging Het
Scn3a T A 2: 65,297,334 (GRCm39) K1442* probably null Het
Sepsecs A G 5: 52,801,391 (GRCm39) S424P probably damaging Het
Set G T 2: 29,960,323 (GRCm39) V219F probably benign Het
Sh3tc1 A T 5: 35,868,295 (GRCm39) F390I probably damaging Het
Simc1 G A 13: 54,695,143 (GRCm39) V1269M probably damaging Het
Ska3 T G 14: 58,047,512 (GRCm39) D341A probably damaging Het
Slc16a10 A T 10: 39,913,411 (GRCm39) probably null Het
Srgap1 T A 10: 121,761,872 (GRCm39) N92I probably damaging Het
Sspo T C 6: 48,431,624 (GRCm39) V639A probably damaging Het
Stk11 A T 10: 79,961,271 (GRCm39) probably benign Het
Sult5a1 G A 8: 123,872,180 (GRCm39) H221Y probably benign Het
Sytl3 T A 17: 7,003,977 (GRCm39) M559K probably benign Het
Tab2 A C 10: 7,794,897 (GRCm39) D528E possibly damaging Het
Tbc1d15 A G 10: 115,057,492 (GRCm39) I218T possibly damaging Het
Tenm4 T A 7: 96,423,221 (GRCm39) M672K possibly damaging Het
Tent4b A T 8: 88,979,182 (GRCm39) Q561L probably benign Het
Tfrc A G 16: 32,437,985 (GRCm39) K346R probably benign Het
Thsd1 G T 8: 22,733,114 (GRCm39) G54W probably damaging Het
Tmprss15 A T 16: 78,800,275 (GRCm39) L618I probably damaging Het
Top3a T C 11: 60,633,790 (GRCm39) S769G probably benign Het
Trp63 C A 16: 25,686,974 (GRCm39) P396Q possibly damaging Het
Uggt1 T C 1: 36,247,065 (GRCm39) S311G probably damaging Het
Usp10 G A 8: 120,678,740 (GRCm39) E574K possibly damaging Het
Wfdc6b T A 2: 164,459,822 (GRCm39) I148K probably damaging Het
Zcchc2 T G 1: 105,945,982 (GRCm39) I474R probably damaging Het
Zdhhc2 A G 8: 40,900,182 (GRCm39) K82R probably benign Het
Zfp273 A G 13: 67,974,135 (GRCm39) D421G possibly damaging Het
Zfp280d T C 9: 72,238,601 (GRCm39) I639T probably damaging Het
Zfp429 A T 13: 67,538,558 (GRCm39) C295* probably null Het
Other mutations in Cadm2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00095:Cadm2 APN 16 66,679,639 (GRCm39) missense probably damaging 1.00
IGL01137:Cadm2 APN 16 66,612,238 (GRCm39) missense probably damaging 1.00
IGL01340:Cadm2 APN 16 66,581,672 (GRCm39) missense possibly damaging 0.62
IGL01406:Cadm2 APN 16 66,612,192 (GRCm39) splice site probably null
IGL02029:Cadm2 APN 16 66,544,182 (GRCm39) missense probably damaging 1.00
IGL02541:Cadm2 APN 16 66,679,771 (GRCm39) critical splice acceptor site probably null
IGL02541:Cadm2 APN 16 66,679,770 (GRCm39) missense possibly damaging 0.73
IGL02952:Cadm2 APN 16 66,461,338 (GRCm39) missense probably damaging 0.99
vitro UTSW 16 66,679,720 (GRCm39) nonsense probably null
R0050:Cadm2 UTSW 16 66,750,154 (GRCm39) splice site probably benign
R0050:Cadm2 UTSW 16 66,750,154 (GRCm39) splice site probably benign
R0399:Cadm2 UTSW 16 66,544,225 (GRCm39) nonsense probably null
R0883:Cadm2 UTSW 16 66,679,702 (GRCm39) missense probably damaging 1.00
R1035:Cadm2 UTSW 16 66,612,235 (GRCm39) missense probably damaging 1.00
R1539:Cadm2 UTSW 16 66,581,727 (GRCm39) missense probably damaging 1.00
R1889:Cadm2 UTSW 16 66,679,683 (GRCm39) missense probably damaging 1.00
R1898:Cadm2 UTSW 16 66,612,271 (GRCm39) missense probably damaging 1.00
R1918:Cadm2 UTSW 16 66,544,270 (GRCm39) splice site probably benign
R2108:Cadm2 UTSW 16 66,528,357 (GRCm39) missense probably benign 0.43
R2570:Cadm2 UTSW 16 66,612,271 (GRCm39) missense probably damaging 1.00
R3878:Cadm2 UTSW 16 66,612,329 (GRCm39) missense probably damaging 1.00
R4093:Cadm2 UTSW 16 66,581,675 (GRCm39) missense possibly damaging 0.94
R4094:Cadm2 UTSW 16 66,679,685 (GRCm39) missense probably damaging 1.00
R5421:Cadm2 UTSW 16 66,568,513 (GRCm39) nonsense probably null
R5555:Cadm2 UTSW 16 66,581,702 (GRCm39) missense probably damaging 1.00
R6173:Cadm2 UTSW 16 66,679,729 (GRCm39) missense probably benign 0.04
R6188:Cadm2 UTSW 16 66,612,195 (GRCm39) critical splice donor site probably null
R6224:Cadm2 UTSW 16 66,461,281 (GRCm39) missense probably damaging 1.00
R6492:Cadm2 UTSW 16 66,581,715 (GRCm39) missense probably damaging 0.98
R6957:Cadm2 UTSW 16 66,609,726 (GRCm39) missense probably benign 0.02
R7051:Cadm2 UTSW 16 66,679,767 (GRCm39) missense possibly damaging 0.86
R7183:Cadm2 UTSW 16 66,679,720 (GRCm39) nonsense probably null
R7322:Cadm2 UTSW 16 66,679,734 (GRCm39) missense probably damaging 1.00
R7882:Cadm2 UTSW 16 66,528,357 (GRCm39) missense probably benign 0.43
R8101:Cadm2 UTSW 16 66,609,730 (GRCm39) missense possibly damaging 0.75
R8166:Cadm2 UTSW 16 66,750,197 (GRCm39) missense probably benign 0.01
R8325:Cadm2 UTSW 16 66,612,338 (GRCm39) missense possibly damaging 0.95
R8496:Cadm2 UTSW 16 66,461,309 (GRCm39) missense probably damaging 1.00
R8746:Cadm2 UTSW 16 66,581,696 (GRCm39) missense probably damaging 0.99
R9396:Cadm2 UTSW 16 66,544,102 (GRCm39) missense probably damaging 0.99
R9732:Cadm2 UTSW 16 66,528,297 (GRCm39) missense probably benign 0.02
X0026:Cadm2 UTSW 16 66,460,038 (GRCm39) missense probably damaging 0.96
Predicted Primers PCR Primer
(F):5'- CCTCACTGTGCCCAAAATTAGATC -3'
(R):5'- TTGTTAAATTGCACAGATGAGAGGG -3'

Sequencing Primer
(F):5'- CACTGTGCCCAAAATTAGATCATTTG -3'
(R):5'- AGAGGGTAGCAGCCTTCTCTC -3'
Posted On 2019-11-26