Mutagenetix > Incidental Mutation

Incidental Mutation 'R7793:Brinp3'

600005

Institutional Source

Beutler Lab

Gene Symbol

Brinp3

Ensembl Gene

ENSMUSG00000035131

Gene Name

bone morphogenetic protein/retinoic acid inducible neural specific 3

Synonyms

Fam5c, B830045N13Rik

MMRRC Submission

Accession Numbers

Essential gene?

Probably non essential (E-score: 0.206) question?

Stock #

R7793 (G1)

Quality Score

225.009

Status

Validated

Chromosome

Chromosomal Location

146494760-146902472 bp(+) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

A to G at 146746568 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Asparagine to Serine at position 236 (N236S)

Ref Sequence

ENSEMBL: ENSMUSP00000074201 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000074622] [ENSMUST00000128345] [ENSMUST00000132847] [ENSMUST00000166814]

AlphaFold

Q499E0

Predicted Effect

probably benign
Transcript: ENSMUST00000074622
AA Change: N236S

PolyPhen 2 Score 0.204 (Sensitivity: 0.92; Specificity: 0.88)

SMART Domains

Protein: ENSMUSP00000074201
Gene: ENSMUSG00000035131
AA Change: N236S

Domain	Start	End	E-Value	Type
signal peptide	1	33	N/A	INTRINSIC
MACPF	78	264	7.69e-42	SMART
low complexity region	315	326	N/A	INTRINSIC
coiled coil region	349	372	N/A	INTRINSIC
EGF	440	475	1.73e1	SMART

Predicted Effect

probably benign
Transcript: ENSMUST00000128345

SMART Domains

Protein: ENSMUSP00000116763
Gene: ENSMUSG00000035131

Domain	Start	End	E-Value	Type
signal peptide	1	33	N/A	INTRINSIC

Predicted Effect

probably benign
Transcript: ENSMUST00000132847
AA Change: N236S

PolyPhen 2 Score 0.204 (Sensitivity: 0.92; Specificity: 0.88)

SMART Domains

Protein: ENSMUSP00000118552
Gene: ENSMUSG00000035131
AA Change: N236S

Domain	Start	End	E-Value	Type
signal peptide	1	33	N/A	INTRINSIC
Blast:MACPF	78	110	1e-16	BLAST

Predicted Effect

probably benign
Transcript: ENSMUST00000166814
AA Change: N236S

PolyPhen 2 Score 0.204 (Sensitivity: 0.92; Specificity: 0.88)

SMART Domains

Protein: ENSMUSP00000126074
Gene: ENSMUSG00000035131
AA Change: N236S

Domain	Start	End	E-Value	Type
signal peptide	1	33	N/A	INTRINSIC
MACPF	78	264	7.69e-42	SMART
low complexity region	315	326	N/A	INTRINSIC
coiled coil region	349	372	N/A	INTRINSIC
EGF	440	475	1.73e1	SMART

Coding Region Coverage

1x: 100.0%
3x: 99.9%
10x: 99.6%
20x: 98.8%

Validation Efficiency

100% (94/94)

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene is overexpressed in pituitary tumors but is underexpressed in tongue squamous cell carcinomas, ulcerative colitis, and peri-implantitis. Polymorphisms that increase expression of this gene have been shown to increase vascular inflammation, and an association of this gene with myocardial infarction has been demonstrated. Finally, hypermethylation of this gene may find usefulness as a biomarker for gastric cancer. Two transcript variants encoding different isoforms have been found for this gene. [provided by RefSeq, Nov 2015]

Allele List at MGI

Other mutations in this stock

Total: 93 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
2200002J24Rik	T	G	7: 30,699,943	I54S	probably damaging	Het
2310002L09Rik	C	T	4: 73,942,935	V143M	probably benign	Het
2610507B11Rik	C	T	11: 78,273,205	P1124L	possibly damaging	Het
Abca1	T	C	4: 53,042,367	I1902V	not run	Het
AI314180	T	C	4: 58,853,150	N395S	probably damaging	Het
Apob	A	C	12: 8,008,124	D2202A	probably damaging	Het
Arhgap44	T	A	11: 65,009,924	S623C	probably damaging	Het
Arhgef7	T	A	8: 11,824,507	W713R	possibly damaging	Het
Axdnd1	A	C	1: 156,338,743		probably null	Het
Bcl9l	T	C	9: 44,508,966	M1223T	probably benign	Het
Bcl9l	C	A	9: 44,509,697	H1467N	probably damaging	Het
Cckbr	T	G	7: 105,433,591	L54V	probably benign	Het
Cd6	G	A	19: 10,798,358	Q246*	probably null	Het
Cep89	G	A	7: 35,429,928	R630H	probably damaging	Het
Ces3a	T	A	8: 105,055,661		probably null	Het
Cgnl1	T	A	9: 71,725,635	N145Y	probably damaging	Het
Col6a5	T	C	9: 105,898,735	D1707G	probably damaging	Het
Cyp2w1	A	G	5: 139,356,140	T103A	probably damaging	Het
Dip2a	A	T	10: 76,278,583	I1021N	probably benign	Het
Dnah2	T	C	11: 69,495,214	T981A	probably benign	Het
Dnah8	A	G	17: 30,855,944	I4546V	probably benign	Het
E2f8	A	C	7: 48,878,075	F106L	probably benign	Het
Eif4g1	G	A	16: 20,688,614	V1413I	probably benign	Het
Epha10	G	A	4: 124,914,453	V688I	probably benign	Het
Exoc2	A	T	13: 30,911,178	V245D	probably benign	Het
Eya4	T	A	10: 23,226,816	E23D	probably benign	Het
Fbxw10	T	A	11: 62,847,387	W36R	possibly damaging	Het
Gabbr1	G	A	17: 37,047,501	G44S	probably benign	Het
Gabrg3	T	A	7: 57,179,580	Q143L	probably benign	Het
Gm14412	A	C	2: 177,315,867	I78M	possibly damaging	Het
Gm35339	T	C	15: 76,359,107	L989P		Het
Gm3854	C	T	7: 6,353,887	S233L	probably damaging	Het
Gm7298	T	C	6: 121,760,604		probably null	Het
Hpse2	A	T	19: 43,388,070	L81Q	probably damaging	Het
Il18r1	A	G	1: 40,471,764	H3R	probably benign	Het
Kansl1l	T	C	1: 66,778,014	K396E	probably damaging	Het
Kbtbd3	T	A	9: 4,331,221	S532T	probably damaging	Het
Lrrtm4	T	C	6: 80,022,858	Y418H	probably damaging	Het
Mfng	G	A	15: 78,773,065	R70C	probably damaging	Het
Mx2	T	A	16: 97,546,883	I236K	probably damaging	Het
Mysm1	T	C	4: 94,965,132	Q410R	probably damaging	Het
Nlrp12	T	C	7: 3,245,400	N100S	probably benign	Het
Nlrp4b	T	A	7: 10,725,074	H773Q	probably benign	Het
Nlrp5	T	A	7: 23,423,918	S735T	possibly damaging	Het
Nt5c2	G	A	19: 46,891,581	R363W	probably benign	Het
Olfr139	T	A	11: 74,044,788	H162L	possibly damaging	Het
Olfr361	A	G	2: 37,084,921	F276L	possibly damaging	Het
Otud7b	A	T	3: 96,155,211	Y589F	probably benign	Het
P2rx1	T	A	11: 73,009,253	C165*	probably null	Het
Pax8	T	C	2: 24,429,597	D354G	possibly damaging	Het
Pdcd11	G	A	19: 47,106,432	V552I	probably benign	Het
Pde6c	G	T	19: 38,159,753	C485F	possibly damaging	Het
Pex5	T	C	6: 124,399,341	Y434C	probably benign	Het
Ppargc1a	T	C	5: 51,462,509		probably null	Het
Prss2	A	T	6: 41,524,952	D224V	possibly damaging	Het
Psd2	A	G	18: 36,002,979	N440S	probably benign	Het
Psmb3	T	A	11: 97,712,439	D159E	probably benign	Het
Ptgr2	T	G	12: 84,307,801	L252R	probably damaging	Het
Ptpro	A	T	6: 137,416,820	N829Y	probably damaging	Het
Rhobtb2	C	A	14: 69,796,831	R315L	probably benign	Het
Rimbp2	A	T	5: 128,789,695	V520D	possibly damaging	Het
Schip1	A	T	3: 68,494,578	Y24F	probably benign	Het
Sdha	A	T	13: 74,331,436	V432E	probably damaging	Het
Sez6	T	C	11: 77,977,600	L929P	probably damaging	Het
Shcbp1l	A	G	1: 153,447,825	I466V	probably benign	Het
Skor1	T	C	9: 63,144,885	S601G	probably damaging	Het
Slc6a7	A	C	18: 61,005,779	L219R	probably damaging	Het
Smok2a	T	C	17: 13,225,626	M30T	possibly damaging	Het
Sp8	A	G	12: 118,849,409	D333G	probably damaging	Het
Spp1	G	A	5: 104,440,334	D201N	probably damaging	Het
Sstr3	A	T	15: 78,540,388	L53Q	probably damaging	Het
Tacc2	T	A	7: 130,623,113	N509K	probably benign	Het
Tdrd1	T	C	19: 56,864,377	V1030A	probably damaging	Het
Tfrc	A	G	16: 32,619,167	K346R	probably benign	Het
Tgm3	G	A	2: 130,012,410		probably null	Het
Tomm5	C	A	4: 45,106,651	L88F	unknown	Het
Trak1	T	A	9: 121,416,198	C46*	probably null	Het
Trim8	A	T	19: 46,515,614	D535V	probably damaging	Het
Trpm7	A	T	2: 126,824,075	Y870*	probably null	Het
Tspoap1	T	C	11: 87,764,310	L286P	probably benign	Het
Ttll3	AAGTA	AAGTAGAGTA	6: 113,399,159		probably null	Het
Ttn	T	A	2: 76,732,045	I28819F	probably damaging	Het
Twf2	T	C	9: 106,211,880	S89P	probably damaging	Het
Ulk4	C	T	9: 121,263,668	E168K	possibly damaging	Het
Unc13b	T	A	4: 43,172,737	N1188K	unknown	Het
Utp6	C	T	11: 79,937,730	V528I	probably benign	Het
Vmn1r78	T	C	7: 12,153,314	F284S	probably benign	Het
Vmn2r54	T	A	7: 12,632,269	Q246L	probably damaging	Het
Vmn2r87	A	G	10: 130,477,544	M451T	probably benign	Het
Vwf	C	T	6: 125,686,520	P2808L		Het
Wwc1	T	C	11: 35,869,109	Q693R	probably benign	Het
Zfp658	T	A	7: 43,574,684	H794Q	possibly damaging	Het
Zfp882	A	G	8: 71,913,141	D8G	probably damaging	Het

Other mutations in Brinp3

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00467:Brinp3	APN	1	146901774	missense	probably damaging	0.99
IGL00503:Brinp3	APN	1	146901167	missense	probably benign
IGL01702:Brinp3	APN	1	146751997	splice site	probably benign
IGL01728:Brinp3	APN	1	146831551	splice site	probably null
IGL01733:Brinp3	APN	1	146514803	missense	probably benign	0.33
IGL01937:Brinp3	APN	1	146901140	missense	probably benign
IGL02020:Brinp3	APN	1	146902127	utr 3 prime	probably benign
IGL02082:Brinp3	APN	1	146751862	missense	probably damaging	1.00
IGL02365:Brinp3	APN	1	146901122	missense	probably benign	0.00
IGL02366:Brinp3	APN	1	146701743	missense	possibly damaging	0.84
IGL02565:Brinp3	APN	1	146902032	missense	probably damaging	0.98
IGL02999:Brinp3	APN	1	146701849	splice site	probably null
IGL03099:Brinp3	APN	1	146902097	missense	possibly damaging	0.91
PIT4283001:Brinp3	UTSW	1	146901423	missense	probably damaging	0.99
PIT4418001:Brinp3	UTSW	1	146901423	missense	probably damaging	0.99
R0021:Brinp3	UTSW	1	146901451	missense	probably benign	0.04
R0021:Brinp3	UTSW	1	146901451	missense	probably benign	0.04
R0266:Brinp3	UTSW	1	146682680	nonsense	probably null
R1468:Brinp3	UTSW	1	146901962	missense	probably benign	0.01
R1468:Brinp3	UTSW	1	146901962	missense	probably benign	0.01
R1522:Brinp3	UTSW	1	146901890	missense	probably damaging	0.99
R1596:Brinp3	UTSW	1	146514782	missense	probably benign
R1898:Brinp3	UTSW	1	146901249	missense	possibly damaging	0.93
R2036:Brinp3	UTSW	1	146701841	missense	possibly damaging	0.84
R2224:Brinp3	UTSW	1	146901920	nonsense	probably null
R2272:Brinp3	UTSW	1	146901404	missense	possibly damaging	0.93
R2291:Brinp3	UTSW	1	146901074	missense	possibly damaging	0.85
R2322:Brinp3	UTSW	1	146701754	missense	probably benign
R2880:Brinp3	UTSW	1	146902002	missense	probably damaging	0.98
R3918:Brinp3	UTSW	1	146751861	missense	probably damaging	0.99
R3939:Brinp3	UTSW	1	146751861	missense	probably damaging	0.99
R3940:Brinp3	UTSW	1	146751861	missense	probably damaging	0.99
R3941:Brinp3	UTSW	1	146751861	missense	probably damaging	0.99
R3942:Brinp3	UTSW	1	146751861	missense	probably damaging	0.99
R4095:Brinp3	UTSW	1	146901692	missense	possibly damaging	0.72
R4783:Brinp3	UTSW	1	146727640	intron	probably benign
R5009:Brinp3	UTSW	1	146901049	missense	probably benign	0.25
R5034:Brinp3	UTSW	1	146727720	intron	probably benign
R5166:Brinp3	UTSW	1	146901367	missense	probably damaging	0.96
R5372:Brinp3	UTSW	1	146831726	missense	probably damaging	1.00
R5472:Brinp3	UTSW	1	146901459	missense	possibly damaging	0.86
R5651:Brinp3	UTSW	1	146701799	missense	probably benign	0.01
R5681:Brinp3	UTSW	1	146901746	missense	probably benign	0.12
R6351:Brinp3	UTSW	1	146901585	missense	probably damaging	0.96
R6470:Brinp3	UTSW	1	146901906	missense	probably damaging	0.99
R6499:Brinp3	UTSW	1	146901693	missense	possibly damaging	0.86
R7078:Brinp3	UTSW	1	146514889	nonsense	probably null
R7223:Brinp3	UTSW	1	146901074	missense	possibly damaging	0.85
R7322:Brinp3	UTSW	1	146682688	nonsense	probably null
R7347:Brinp3	UTSW	1	146902086	missense	probably benign	0.22
R7375:Brinp3	UTSW	1	146902010	missense	possibly damaging	0.91
R7412:Brinp3	UTSW	1	146902010	missense	possibly damaging	0.91
R7532:Brinp3	UTSW	1	146901401	missense	probably damaging	0.98
R7562:Brinp3	UTSW	1	146902010	missense	possibly damaging	0.91
R7576:Brinp3	UTSW	1	146901563	missense	probably damaging	0.99
R7723:Brinp3	UTSW	1	146701671	missense	probably damaging	1.00
R7737:Brinp3	UTSW	1	146682594	missense	probably damaging	0.98
R8334:Brinp3	UTSW	1	146902053	missense	probably damaging	0.99
R8401:Brinp3	UTSW	1	146901446	missense	probably benign	0.17
R9205:Brinp3	UTSW	1	146902089	missense	possibly damaging	0.57
R9328:Brinp3	UTSW	1	146831717	missense	probably damaging	0.98
R9602:Brinp3	UTSW	1	146746496	missense	probably damaging	1.00
X0060:Brinp3	UTSW	1	146901786	missense	probably benign	0.01
Z1176:Brinp3	UTSW	1	146902076	missense	probably damaging	0.99

Predicted Primers

PCR Primer
(F):5'- AGTTTCAGAAAAGCATACTCAACAG -3'
(R):5'- CAACTTATTTGGTTGATGGTCTAGATC -3'

Sequencing Primer
(F):5'- AGAAAAGCATACTCAACAGAAAGTAC -3'
(R):5'- TTGCAGATGTCTCAGAACCCTAGG -3'

Posted On

2019-11-26