Incidental Mutation 'R7793:Spp1'
ID600022
Institutional Source Beutler Lab
Gene Symbol Spp1
Ensembl Gene ENSMUSG00000029304
Gene Namesecreted phosphoprotein 1
SynonymsOpn, ETA-1, OP, Spp-1, osteopontin-like protein, bone sialoprotein 1, 44kDa bone phosphoprotein, osteopontin, Apl-1, Opnl, BNSP, Ric, 2ar, minopontin
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R7793 (G1)
Quality Score225.009
Status Validated
Chromosome5
Chromosomal Location104435118-104441050 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) G to A at 104440334 bp
ZygosityHeterozygous
Amino Acid Change Aspartic acid to Asparagine at position 201 (D201N)
Ref Sequence ENSEMBL: ENSMUSP00000031243 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000031243] [ENSMUST00000086833] [ENSMUST00000112746] [ENSMUST00000112747] [ENSMUST00000112748] [ENSMUST00000132457] [ENSMUST00000145084]
Predicted Effect probably damaging
Transcript: ENSMUST00000031243
AA Change: D201N

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000031243
Gene: ENSMUSG00000029304
AA Change: D201N

DomainStartEndE-ValueType
signal peptide 1 16 N/A INTRINSIC
OSTEO 17 294 2.5e-157 SMART
Predicted Effect possibly damaging
Transcript: ENSMUST00000086833
AA Change: D202N

PolyPhen 2 Score 0.922 (Sensitivity: 0.81; Specificity: 0.94)
SMART Domains Protein: ENSMUSP00000084043
Gene: ENSMUSG00000029304
AA Change: D202N

DomainStartEndE-ValueType
signal peptide 1 16 N/A INTRINSIC
OSTEO 17 295 2.21e-158 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000112746
SMART Domains Protein: ENSMUSP00000108366
Gene: ENSMUSG00000029304

DomainStartEndE-ValueType
signal peptide 1 16 N/A INTRINSIC
Pfam:Osteopontin 20 164 2.2e-67 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000112747
AA Change: D201N

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000108367
Gene: ENSMUSG00000029304
AA Change: D201N

DomainStartEndE-ValueType
signal peptide 1 16 N/A INTRINSIC
OSTEO 17 294 2.5e-157 SMART
Predicted Effect probably damaging
Transcript: ENSMUST00000112748
AA Change: D201N

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000108368
Gene: ENSMUSG00000029304
AA Change: D201N

DomainStartEndE-ValueType
signal peptide 1 16 N/A INTRINSIC
OSTEO 17 294 2.5e-157 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000132457
Predicted Effect probably benign
Transcript: ENSMUST00000145084
SMART Domains Protein: ENSMUSP00000117338
Gene: ENSMUSG00000029304

DomainStartEndE-ValueType
signal peptide 1 16 N/A INTRINSIC
Pfam:Osteopontin 20 152 1.2e-60 PFAM
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.6%
  • 20x: 98.8%
Validation Efficiency 100% (94/94)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene is involved in the attachment of osteoclasts to the mineralized bone matrix. The encoded protein is secreted and binds hydroxyapatite with high affinity. The osteoclast vitronectin receptor is found in the cell membrane and may be involved in the binding to this protein. This protein is also a cytokine that upregulates expression of interferon-gamma and interleukin-12. Several transcript variants encoding different isoforms have been found for this gene. [provided by RefSeq, Oct 2011]
PHENOTYPE: Two alleles determine natural resistance/susceptibility to the lethal effects of the Gilliam strain of Rickettsia tsutsugamushi. Mice homozygous for a knock-out allele exhibit abnormal osteoclast physiology, macrophage recruitment, wound healing, response to injury, and inflammatory response. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 93 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2200002J24Rik T G 7: 30,699,943 I54S probably damaging Het
2310002L09Rik C T 4: 73,942,935 V143M probably benign Het
2610507B11Rik C T 11: 78,273,205 P1124L possibly damaging Het
Abca1 T C 4: 53,042,367 I1902V not run Het
AI314180 T C 4: 58,853,150 N395S probably damaging Het
Apob A C 12: 8,008,124 D2202A probably damaging Het
Arhgap44 T A 11: 65,009,924 S623C probably damaging Het
Arhgef7 T A 8: 11,824,507 W713R possibly damaging Het
Axdnd1 A C 1: 156,338,743 probably null Het
Bcl9l T C 9: 44,508,966 M1223T probably benign Het
Bcl9l C A 9: 44,509,697 H1467N probably damaging Het
Brinp3 A G 1: 146,746,568 N236S probably benign Het
Cckbr T G 7: 105,433,591 L54V probably benign Het
Cd6 G A 19: 10,798,358 Q246* probably null Het
Cep89 G A 7: 35,429,928 R630H probably damaging Het
Ces3a T A 8: 105,055,661 probably null Het
Cgnl1 T A 9: 71,725,635 N145Y probably damaging Het
Col6a5 T C 9: 105,898,735 D1707G probably damaging Het
Cyp2w1 A G 5: 139,356,140 T103A probably damaging Het
Dip2a A T 10: 76,278,583 I1021N probably benign Het
Dnah2 T C 11: 69,495,214 T981A probably benign Het
Dnah8 A G 17: 30,855,944 I4546V probably benign Het
E2f8 A C 7: 48,878,075 F106L probably benign Het
Eif4g1 G A 16: 20,688,614 V1413I probably benign Het
Epha10 G A 4: 124,914,453 V688I probably benign Het
Exoc2 A T 13: 30,911,178 V245D probably benign Het
Eya4 T A 10: 23,226,816 E23D probably benign Het
Fbxw10 T A 11: 62,847,387 W36R possibly damaging Het
Gabbr1 G A 17: 37,047,501 G44S probably benign Het
Gabrg3 T A 7: 57,179,580 Q143L probably benign Het
Gm14412 A C 2: 177,315,867 I78M possibly damaging Het
Gm35339 T C 15: 76,359,107 L989P Het
Gm3854 C T 7: 6,353,887 S233L probably damaging Het
Gm7298 T C 6: 121,760,604 probably null Het
Hpse2 A T 19: 43,388,070 L81Q probably damaging Het
Il18r1 A G 1: 40,471,764 H3R probably benign Het
Kansl1l T C 1: 66,778,014 K396E probably damaging Het
Kbtbd3 T A 9: 4,331,221 S532T probably damaging Het
Lrrtm4 T C 6: 80,022,858 Y418H probably damaging Het
Mfng G A 15: 78,773,065 R70C probably damaging Het
Mx2 T A 16: 97,546,883 I236K probably damaging Het
Mysm1 T C 4: 94,965,132 Q410R probably damaging Het
Nlrp12 T C 7: 3,245,400 N100S probably benign Het
Nlrp4b T A 7: 10,725,074 H773Q probably benign Het
Nlrp5 T A 7: 23,423,918 S735T possibly damaging Het
Nt5c2 G A 19: 46,891,581 R363W probably benign Het
Olfr139 T A 11: 74,044,788 H162L possibly damaging Het
Olfr361 A G 2: 37,084,921 F276L possibly damaging Het
Otud7b A T 3: 96,155,211 Y589F probably benign Het
P2rx1 T A 11: 73,009,253 C165* probably null Het
Pax8 T C 2: 24,429,597 D354G possibly damaging Het
Pdcd11 G A 19: 47,106,432 V552I probably benign Het
Pde6c G T 19: 38,159,753 C485F possibly damaging Het
Pex5 T C 6: 124,399,341 Y434C probably benign Het
Ppargc1a T C 5: 51,462,509 probably null Het
Prss2 A T 6: 41,524,952 D224V possibly damaging Het
Psd2 A G 18: 36,002,979 N440S probably benign Het
Psmb3 T A 11: 97,712,439 D159E probably benign Het
Ptgr2 T G 12: 84,307,801 L252R probably damaging Het
Ptpro A T 6: 137,416,820 N829Y probably damaging Het
Rhobtb2 C A 14: 69,796,831 R315L probably benign Het
Rimbp2 A T 5: 128,789,695 V520D possibly damaging Het
Schip1 A T 3: 68,494,578 Y24F probably benign Het
Sdha A T 13: 74,331,436 V432E probably damaging Het
Sez6 T C 11: 77,977,600 L929P probably damaging Het
Shcbp1l A G 1: 153,447,825 I466V probably benign Het
Skor1 T C 9: 63,144,885 S601G probably damaging Het
Slc6a7 A C 18: 61,005,779 L219R probably damaging Het
Smok2a T C 17: 13,225,626 M30T possibly damaging Het
Sp8 A G 12: 118,849,409 D333G probably damaging Het
Sstr3 A T 15: 78,540,388 L53Q probably damaging Het
Tacc2 T A 7: 130,623,113 N509K probably benign Het
Tdrd1 T C 19: 56,864,377 V1030A probably damaging Het
Tfrc A G 16: 32,619,167 K346R probably benign Het
Tgm3 G A 2: 130,012,410 probably null Het
Tomm5 C A 4: 45,106,651 L88F unknown Het
Trak1 T A 9: 121,416,198 C46* probably null Het
Trim8 A T 19: 46,515,614 D535V probably damaging Het
Trpm7 A T 2: 126,824,075 Y870* probably null Het
Tspoap1 T C 11: 87,764,310 L286P probably benign Het
Ttll3 AAGTA AAGTAGAGTA 6: 113,399,159 probably null Het
Ttn T A 2: 76,732,045 I28819F probably damaging Het
Twf2 T C 9: 106,211,880 S89P probably damaging Het
Ulk4 C T 9: 121,263,668 E168K possibly damaging Het
Unc13b T A 4: 43,172,737 N1188K unknown Het
Utp6 C T 11: 79,937,730 V528I probably benign Het
Vmn1r78 T C 7: 12,153,314 F284S probably benign Het
Vmn2r54 T A 7: 12,632,269 Q246L probably damaging Het
Vmn2r87 A G 10: 130,477,544 M451T probably benign Het
Vwf C T 6: 125,686,520 P2808L Het
Wwc1 T C 11: 35,869,109 Q693R probably benign Het
Zfp658 T A 7: 43,574,684 H794Q possibly damaging Het
Zfp882 A G 8: 71,913,141 D8G probably damaging Het
Other mutations in Spp1
AlleleSourceChrCoordTypePredicted EffectPPH Score
R4755:Spp1 UTSW 5 104435215 intron probably benign
R4969:Spp1 UTSW 5 104440287 missense possibly damaging 0.68
R5531:Spp1 UTSW 5 104440558 missense probably benign 0.12
R6198:Spp1 UTSW 5 104439508 unclassified probably null
R6291:Spp1 UTSW 5 104439376 missense possibly damaging 0.89
R6636:Spp1 UTSW 5 104440530 missense possibly damaging 0.51
R7029:Spp1 UTSW 5 104439301 missense probably benign 0.02
R7228:Spp1 UTSW 5 104440445 missense probably damaging 0.99
R7695:Spp1 UTSW 5 104435143 start gained probably benign
R8050:Spp1 UTSW 5 104440414 missense probably benign 0.00
X0011:Spp1 UTSW 5 104440422 missense possibly damaging 0.85
Predicted Primers PCR Primer
(F):5'- ATGATTGATATGAAGCTGACTGGTG -3'
(R):5'- CTTGTCCTTGTGGCTGTGAAAC -3'

Sequencing Primer
(F):5'- GCTGACTGGTGAAATATAAAGTACAC -3'
(R):5'- AAACTTGTGGCTCTGATGTTCCAG -3'
Posted On2019-11-26