Incidental Mutation 'R7793:Nlrp5'
ID600038
Institutional Source Beutler Lab
Gene Symbol Nlrp5
Ensembl Gene ENSMUSG00000015721
Gene NameNLR family, pyrin domain containing 5
SynonymsMater, Nalp5, Op1
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.164) question?
Stock #R7793 (G1)
Quality Score225.009
Status Validated
Chromosome7
Chromosomal Location23385889-23441922 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to A at 23423918 bp
ZygosityHeterozygous
Amino Acid Change Serine to Threonine at position 735 (S735T)
Ref Sequence ENSEMBL: ENSMUSP00000015866 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000015866] [ENSMUST00000086341] [ENSMUST00000108441] [ENSMUST00000133237] [ENSMUST00000139661]
Predicted Effect possibly damaging
Transcript: ENSMUST00000015866
AA Change: S735T

PolyPhen 2 Score 0.871 (Sensitivity: 0.83; Specificity: 0.93)
SMART Domains Protein: ENSMUSP00000015866
Gene: ENSMUSG00000015721
AA Change: S735T

DomainStartEndE-ValueType
Pfam:NACHT 191 359 3.5e-45 PFAM
LRR 691 718 4.51e1 SMART
LRR 747 774 1.36e-2 SMART
LRR 776 803 6.79e0 SMART
LRR 804 831 4.3e0 SMART
LRR 833 860 1.42e0 SMART
LRR 861 888 1.2e-3 SMART
LRR 890 917 1.2e2 SMART
LRR 918 945 2.2e-2 SMART
LRR 947 974 1.56e2 SMART
LRR 975 1002 3.36e-7 SMART
LRR 1004 1031 6.04e1 SMART
LRR 1032 1059 1.99e1 SMART
Predicted Effect possibly damaging
Transcript: ENSMUST00000086341
AA Change: S719T

PolyPhen 2 Score 0.543 (Sensitivity: 0.88; Specificity: 0.91)
SMART Domains Protein: ENSMUSP00000083524
Gene: ENSMUSG00000015721
AA Change: S719T

DomainStartEndE-ValueType
Pfam:NACHT 175 343 1.5e-44 PFAM
LRR 675 702 4.51e1 SMART
LRR 731 758 1.36e-2 SMART
LRR 760 787 6.79e0 SMART
LRR 788 815 4.3e0 SMART
LRR 817 844 1.42e0 SMART
LRR 845 872 1.2e-3 SMART
LRR 874 901 1.2e2 SMART
LRR 902 929 2.2e-2 SMART
LRR 931 958 1.56e2 SMART
LRR 959 986 3.36e-7 SMART
LRR 988 1015 6.04e1 SMART
LRR 1016 1043 1.99e1 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000108441
AA Change: S735T

PolyPhen 2 Score 0.286 (Sensitivity: 0.91; Specificity: 0.88)
SMART Domains Protein: ENSMUSP00000104080
Gene: ENSMUSG00000015721
AA Change: S735T

DomainStartEndE-ValueType
Pfam:NACHT 191 359 1.5e-44 PFAM
LRR 691 718 4.51e1 SMART
LRR 747 774 1.36e-2 SMART
LRR 776 803 6.79e0 SMART
LRR 804 831 4.3e0 SMART
LRR 833 860 1.42e0 SMART
LRR 861 888 1.2e-3 SMART
LRR 890 917 1.2e2 SMART
LRR 918 945 2.2e-2 SMART
LRR 947 974 1.56e2 SMART
LRR 975 1002 3.36e-7 SMART
LRR 1004 1033 1.28e2 SMART
Predicted Effect possibly damaging
Transcript: ENSMUST00000133237
AA Change: S735T

PolyPhen 2 Score 0.935 (Sensitivity: 0.80; Specificity: 0.94)
SMART Domains Protein: ENSMUSP00000122007
Gene: ENSMUSG00000015721
AA Change: S735T

DomainStartEndE-ValueType
Pfam:NACHT 191 359 1.3e-44 PFAM
LRR 691 718 4.51e1 SMART
LRR 747 774 1.36e-2 SMART
LRR 776 803 6.79e0 SMART
LRR 804 831 4.3e0 SMART
LRR 833 860 1.42e0 SMART
LRR 861 888 1.2e-3 SMART
LRR 890 917 1.2e2 SMART
LRR 918 945 2.2e-2 SMART
LRR 947 974 1.56e2 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000139661
SMART Domains Protein: ENSMUSP00000118638
Gene: ENSMUSG00000015721

DomainStartEndE-ValueType
Pfam:NACHT 191 359 1.6e-44 PFAM
Blast:LRR 691 718 8e-9 BLAST
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.6%
  • 20x: 98.8%
Validation Efficiency 100% (94/94)
MGI Phenotype FUNCTION: This gene encodes a member of the NACHT, leucine-rich repeat, and pyrin domain containing family. Members of this family have a pyrin domain at the N-terminus, a central NACHT domain, and a C-terminal leucine-rich repeat domain. This gene encodes a maternal-effect factor that is essential for early embryonic development in the mouse. Homozygous null mutant females are sterile, and embryos die following the first cleavage. This gene is required for endoplasmic reticulum redistribution and calcium homeostasis in oocytes. In addition, ovulated oocytes mutant for this gene have abnormal mitochondrial localization and increased mitochondrial activity, which results in mitochondrial damage and early embryonic lethality. Pseudogenes of this gene have been found on chromosomes 7 and 12. Alternative splicing results in multiple transcript variants. [provided by RefSeq, Apr 2015]
PHENOTYPE: Females lacking this maternal effect gene are sterile. Preimplantation embryos do not develop past the 2-cell stage. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 93 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2200002J24Rik T G 7: 30,699,943 I54S probably damaging Het
2310002L09Rik C T 4: 73,942,935 V143M probably benign Het
2610507B11Rik C T 11: 78,273,205 P1124L possibly damaging Het
Abca1 T C 4: 53,042,367 I1902V not run Het
AI314180 T C 4: 58,853,150 N395S probably damaging Het
Apob A C 12: 8,008,124 D2202A probably damaging Het
Arhgap44 T A 11: 65,009,924 S623C probably damaging Het
Arhgef7 T A 8: 11,824,507 W713R possibly damaging Het
Axdnd1 A C 1: 156,338,743 probably null Het
Bcl9l T C 9: 44,508,966 M1223T probably benign Het
Bcl9l C A 9: 44,509,697 H1467N probably damaging Het
Brinp3 A G 1: 146,746,568 N236S probably benign Het
Cckbr T G 7: 105,433,591 L54V probably benign Het
Cd6 G A 19: 10,798,358 Q246* probably null Het
Cep89 G A 7: 35,429,928 R630H probably damaging Het
Ces3a T A 8: 105,055,661 probably null Het
Cgnl1 T A 9: 71,725,635 N145Y probably damaging Het
Col6a5 T C 9: 105,898,735 D1707G probably damaging Het
Cyp2w1 A G 5: 139,356,140 T103A probably damaging Het
Dip2a A T 10: 76,278,583 I1021N probably benign Het
Dnah2 T C 11: 69,495,214 T981A probably benign Het
Dnah8 A G 17: 30,855,944 I4546V probably benign Het
E2f8 A C 7: 48,878,075 F106L probably benign Het
Eif4g1 G A 16: 20,688,614 V1413I probably benign Het
Epha10 G A 4: 124,914,453 V688I probably benign Het
Exoc2 A T 13: 30,911,178 V245D probably benign Het
Eya4 T A 10: 23,226,816 E23D probably benign Het
Fbxw10 T A 11: 62,847,387 W36R possibly damaging Het
Gabbr1 G A 17: 37,047,501 G44S probably benign Het
Gabrg3 T A 7: 57,179,580 Q143L probably benign Het
Gm14412 A C 2: 177,315,867 I78M possibly damaging Het
Gm35339 T C 15: 76,359,107 L989P Het
Gm3854 C T 7: 6,353,887 S233L probably damaging Het
Gm7298 T C 6: 121,760,604 probably null Het
Hpse2 A T 19: 43,388,070 L81Q probably damaging Het
Il18r1 A G 1: 40,471,764 H3R probably benign Het
Kansl1l T C 1: 66,778,014 K396E probably damaging Het
Kbtbd3 T A 9: 4,331,221 S532T probably damaging Het
Lrrtm4 T C 6: 80,022,858 Y418H probably damaging Het
Mfng G A 15: 78,773,065 R70C probably damaging Het
Mx2 T A 16: 97,546,883 I236K probably damaging Het
Mysm1 T C 4: 94,965,132 Q410R probably damaging Het
Nlrp12 T C 7: 3,245,400 N100S probably benign Het
Nlrp4b T A 7: 10,725,074 H773Q probably benign Het
Nt5c2 G A 19: 46,891,581 R363W probably benign Het
Olfr139 T A 11: 74,044,788 H162L possibly damaging Het
Olfr361 A G 2: 37,084,921 F276L possibly damaging Het
Otud7b A T 3: 96,155,211 Y589F probably benign Het
P2rx1 T A 11: 73,009,253 C165* probably null Het
Pax8 T C 2: 24,429,597 D354G possibly damaging Het
Pdcd11 G A 19: 47,106,432 V552I probably benign Het
Pde6c G T 19: 38,159,753 C485F possibly damaging Het
Pex5 T C 6: 124,399,341 Y434C probably benign Het
Ppargc1a T C 5: 51,462,509 probably null Het
Prss2 A T 6: 41,524,952 D224V possibly damaging Het
Psd2 A G 18: 36,002,979 N440S probably benign Het
Psmb3 T A 11: 97,712,439 D159E probably benign Het
Ptgr2 T G 12: 84,307,801 L252R probably damaging Het
Ptpro A T 6: 137,416,820 N829Y probably damaging Het
Rhobtb2 C A 14: 69,796,831 R315L probably benign Het
Rimbp2 A T 5: 128,789,695 V520D possibly damaging Het
Schip1 A T 3: 68,494,578 Y24F probably benign Het
Sdha A T 13: 74,331,436 V432E probably damaging Het
Sez6 T C 11: 77,977,600 L929P probably damaging Het
Shcbp1l A G 1: 153,447,825 I466V probably benign Het
Skor1 T C 9: 63,144,885 S601G probably damaging Het
Slc6a7 A C 18: 61,005,779 L219R probably damaging Het
Smok2a T C 17: 13,225,626 M30T possibly damaging Het
Sp8 A G 12: 118,849,409 D333G probably damaging Het
Spp1 G A 5: 104,440,334 D201N probably damaging Het
Sstr3 A T 15: 78,540,388 L53Q probably damaging Het
Tacc2 T A 7: 130,623,113 N509K probably benign Het
Tdrd1 T C 19: 56,864,377 V1030A probably damaging Het
Tfrc A G 16: 32,619,167 K346R probably benign Het
Tgm3 G A 2: 130,012,410 probably null Het
Tomm5 C A 4: 45,106,651 L88F unknown Het
Trak1 T A 9: 121,416,198 C46* probably null Het
Trim8 A T 19: 46,515,614 D535V probably damaging Het
Trpm7 A T 2: 126,824,075 Y870* probably null Het
Tspoap1 T C 11: 87,764,310 L286P probably benign Het
Ttll3 AAGTA AAGTAGAGTA 6: 113,399,159 probably null Het
Ttn T A 2: 76,732,045 I28819F probably damaging Het
Twf2 T C 9: 106,211,880 S89P probably damaging Het
Ulk4 C T 9: 121,263,668 E168K possibly damaging Het
Unc13b T A 4: 43,172,737 N1188K unknown Het
Utp6 C T 11: 79,937,730 V528I probably benign Het
Vmn1r78 T C 7: 12,153,314 F284S probably benign Het
Vmn2r54 T A 7: 12,632,269 Q246L probably damaging Het
Vmn2r87 A G 10: 130,477,544 M451T probably benign Het
Vwf C T 6: 125,686,520 P2808L Het
Wwc1 T C 11: 35,869,109 Q693R probably benign Het
Zfp658 T A 7: 43,574,684 H794Q possibly damaging Het
Zfp882 A G 8: 71,913,141 D8G probably damaging Het
Other mutations in Nlrp5
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00478:Nlrp5 APN 7 23441788 missense probably damaging 1.00
IGL01393:Nlrp5 APN 7 23404174 missense probably null 0.04
IGL01505:Nlrp5 APN 7 23417734 missense probably benign 0.15
IGL02010:Nlrp5 APN 7 23417372 missense probably benign 0.04
IGL02223:Nlrp5 APN 7 23430022 splice site probably benign
IGL02341:Nlrp5 APN 7 23404152 missense probably benign 0.43
IGL02532:Nlrp5 APN 7 23409973 missense possibly damaging 0.70
IGL02619:Nlrp5 APN 7 23424064 critical splice donor site probably null
IGL02659:Nlrp5 APN 7 23418581 missense probably damaging 1.00
IGL02828:Nlrp5 APN 7 23421460 missense possibly damaging 0.81
IGL03018:Nlrp5 APN 7 23417747 missense probably benign 0.06
IGL03164:Nlrp5 APN 7 23418373 nonsense probably null
IGL03397:Nlrp5 APN 7 23413334 missense probably damaging 1.00
IGL03404:Nlrp5 APN 7 23430034 missense probably benign 0.00
R0310:Nlrp5 UTSW 7 23430157 missense probably damaging 0.99
R0549:Nlrp5 UTSW 7 23441802 missense probably damaging 1.00
R0573:Nlrp5 UTSW 7 23417631 missense probably damaging 1.00
R0647:Nlrp5 UTSW 7 23417707 missense probably damaging 1.00
R0675:Nlrp5 UTSW 7 23417417 missense possibly damaging 0.53
R0826:Nlrp5 UTSW 7 23417708 missense probably benign 0.13
R1511:Nlrp5 UTSW 7 23413347 missense probably damaging 0.99
R1620:Nlrp5 UTSW 7 23418639 missense probably damaging 1.00
R1858:Nlrp5 UTSW 7 23418161 missense probably damaging 0.98
R1867:Nlrp5 UTSW 7 23423982 missense possibly damaging 0.85
R1887:Nlrp5 UTSW 7 23417484 missense probably damaging 1.00
R1899:Nlrp5 UTSW 7 23404797 missense probably benign 0.00
R1901:Nlrp5 UTSW 7 23423910 missense possibly damaging 0.94
R2032:Nlrp5 UTSW 7 23421512 missense probably damaging 1.00
R3083:Nlrp5 UTSW 7 23430163 missense probably benign 0.03
R3806:Nlrp5 UTSW 7 23404846 missense probably benign
R3907:Nlrp5 UTSW 7 23433646 missense possibly damaging 0.48
R4085:Nlrp5 UTSW 7 23430098 missense probably damaging 0.97
R4135:Nlrp5 UTSW 7 23418398 missense possibly damaging 0.92
R4609:Nlrp5 UTSW 7 23417748 missense probably benign 0.01
R4649:Nlrp5 UTSW 7 23418178 missense probably damaging 1.00
R4780:Nlrp5 UTSW 7 23435778 missense probably damaging 1.00
R4793:Nlrp5 UTSW 7 23417630 missense probably damaging 0.97
R5062:Nlrp5 UTSW 7 23435910 nonsense probably null
R5224:Nlrp5 UTSW 7 23417976 missense probably damaging 1.00
R5364:Nlrp5 UTSW 7 23418328 nonsense probably null
R5426:Nlrp5 UTSW 7 23418201 missense probably damaging 1.00
R5488:Nlrp5 UTSW 7 23417934 missense probably benign 0.03
R5762:Nlrp5 UTSW 7 23418839 missense possibly damaging 0.89
R6014:Nlrp5 UTSW 7 23409947 missense probably benign 0.02
R6130:Nlrp5 UTSW 7 23404173 missense probably benign 0.00
R6277:Nlrp5 UTSW 7 23421455 missense probably damaging 1.00
R6509:Nlrp5 UTSW 7 23417916 missense probably damaging 1.00
R6519:Nlrp5 UTSW 7 23417918 missense probably benign 0.22
R7042:Nlrp5 UTSW 7 23417480 missense possibly damaging 0.52
R7253:Nlrp5 UTSW 7 23417391 missense possibly damaging 0.93
R7336:Nlrp5 UTSW 7 23417634 missense probably damaging 0.98
R7371:Nlrp5 UTSW 7 23418423 missense probably damaging 0.99
R7449:Nlrp5 UTSW 7 23417526 missense probably benign 0.00
R7505:Nlrp5 UTSW 7 23407500 missense probably benign 0.01
R7580:Nlrp5 UTSW 7 23433749 missense probably damaging 1.00
R7588:Nlrp5 UTSW 7 23408151 missense probably benign 0.21
R7795:Nlrp5 UTSW 7 23418794 missense possibly damaging 0.78
R7893:Nlrp5 UTSW 7 23418165 missense probably benign 0.12
R7976:Nlrp5 UTSW 7 23418165 missense probably benign 0.12
R8071:Nlrp5 UTSW 7 23418444 missense probably damaging 1.00
RF007:Nlrp5 UTSW 7 23418161 missense probably benign 0.16
U24488:Nlrp5 UTSW 7 23418228 missense possibly damaging 0.94
X0026:Nlrp5 UTSW 7 23417498 nonsense probably null
X0062:Nlrp5 UTSW 7 23417990 nonsense probably null
Z1088:Nlrp5 UTSW 7 23404167 missense possibly damaging 0.82
Z1088:Nlrp5 UTSW 7 23417586 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- GAAACTCTGTCTCAGAAACAAACTG -3'
(R):5'- AGTTCACCACCCACAAGTTG -3'

Sequencing Primer
(F):5'- CTGTATGCAAAGAGCTACAGC -3'
(R):5'- GCTGTATTTTTCAACTTCCTGGAAG -3'
Posted On2019-11-26