Incidental Mutation 'R7793:Eya4'
ID600057
Institutional Source Beutler Lab
Gene Symbol Eya4
Ensembl Gene ENSMUSG00000010461
Gene NameEYA transcriptional coactivator and phosphatase 4
SynonymsB130023L16Rik
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R7793 (G1)
Quality Score225.009
Status Validated
Chromosome10
Chromosomal Location23102963-23350786 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to A at 23226816 bp
ZygosityHeterozygous
Amino Acid Change Glutamic Acid to Aspartic acid at position 23 (E23D)
Ref Sequence ENSEMBL: ENSMUSP00000090335 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000074366] [ENSMUST00000092665] [ENSMUST00000218049] [ENSMUST00000219315] [ENSMUST00000220299]
Predicted Effect probably benign
Transcript: ENSMUST00000074366
AA Change: E23D

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
SMART Domains Protein: ENSMUSP00000073970
Gene: ENSMUSG00000010461
AA Change: E23D

DomainStartEndE-ValueType
low complexity region 49 72 N/A INTRINSIC
low complexity region 231 243 N/A INTRINSIC
low complexity region 322 334 N/A INTRINSIC
PDB:4EGC|B 336 616 1e-163 PDB
Predicted Effect probably benign
Transcript: ENSMUST00000092665
AA Change: E23D

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
SMART Domains Protein: ENSMUSP00000090335
Gene: ENSMUSG00000010461
AA Change: E23D

DomainStartEndE-ValueType
low complexity region 49 72 N/A INTRINSIC
low complexity region 231 243 N/A INTRINSIC
low complexity region 322 334 N/A INTRINSIC
PDB:4EGC|B 336 616 1e-172 PDB
Predicted Effect probably benign
Transcript: ENSMUST00000218049
Predicted Effect probably benign
Transcript: ENSMUST00000219315
AA Change: E23D

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
Predicted Effect probably benign
Transcript: ENSMUST00000220299
AA Change: E23D

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.6%
  • 20x: 98.8%
Validation Efficiency 100% (94/94)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of the eyes absent (EYA) family of proteins. The encoded protein may act as a transcriptional activator through its protein phosphatase activity, and it may be important for eye development, and for continued function of the mature organ of Corti. Mutations in this gene are associated with postlingual, progressive, autosomal dominant hearing loss at the deafness, autosomal dominant non-syndromic sensorineural 10 locus. The encoded protein is also a putative oncogene that mediates DNA repair, apoptosis, and innate immunity following DNA damage, cellular damage, and viral attack. Defects in this gene are also associated with dilated cardiomyopathy 1J. Alternative splicing results in multiple transcript variants encoding distinct isoforms. [provided by RefSeq, Jul 2014]
PHENOTYPE: Homozygous null mice show strain background-dependent postnatal lethality, reduced body weight, male sterility, a delay in palate bone fusion, developmental defects in the eustachian tube and middle ear cavity, early-onset hearing deficits, and profound susceptibility to otitis media with effusion. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 93 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2200002J24Rik T G 7: 30,699,943 I54S probably damaging Het
2310002L09Rik C T 4: 73,942,935 V143M probably benign Het
2610507B11Rik C T 11: 78,273,205 P1124L possibly damaging Het
Abca1 T C 4: 53,042,367 I1902V not run Het
AI314180 T C 4: 58,853,150 N395S probably damaging Het
Apob A C 12: 8,008,124 D2202A probably damaging Het
Arhgap44 T A 11: 65,009,924 S623C probably damaging Het
Arhgef7 T A 8: 11,824,507 W713R possibly damaging Het
Axdnd1 A C 1: 156,338,743 probably null Het
Bcl9l T C 9: 44,508,966 M1223T probably benign Het
Bcl9l C A 9: 44,509,697 H1467N probably damaging Het
Brinp3 A G 1: 146,746,568 N236S probably benign Het
Cckbr T G 7: 105,433,591 L54V probably benign Het
Cd6 G A 19: 10,798,358 Q246* probably null Het
Cep89 G A 7: 35,429,928 R630H probably damaging Het
Ces3a T A 8: 105,055,661 probably null Het
Cgnl1 T A 9: 71,725,635 N145Y probably damaging Het
Col6a5 T C 9: 105,898,735 D1707G probably damaging Het
Cyp2w1 A G 5: 139,356,140 T103A probably damaging Het
Dip2a A T 10: 76,278,583 I1021N probably benign Het
Dnah2 T C 11: 69,495,214 T981A probably benign Het
Dnah8 A G 17: 30,855,944 I4546V probably benign Het
E2f8 A C 7: 48,878,075 F106L probably benign Het
Eif4g1 G A 16: 20,688,614 V1413I probably benign Het
Epha10 G A 4: 124,914,453 V688I probably benign Het
Exoc2 A T 13: 30,911,178 V245D probably benign Het
Fbxw10 T A 11: 62,847,387 W36R possibly damaging Het
Gabbr1 G A 17: 37,047,501 G44S probably benign Het
Gabrg3 T A 7: 57,179,580 Q143L probably benign Het
Gm14412 A C 2: 177,315,867 I78M possibly damaging Het
Gm35339 T C 15: 76,359,107 L989P Het
Gm3854 C T 7: 6,353,887 S233L probably damaging Het
Gm7298 T C 6: 121,760,604 probably null Het
Hpse2 A T 19: 43,388,070 L81Q probably damaging Het
Il18r1 A G 1: 40,471,764 H3R probably benign Het
Kansl1l T C 1: 66,778,014 K396E probably damaging Het
Kbtbd3 T A 9: 4,331,221 S532T probably damaging Het
Lrrtm4 T C 6: 80,022,858 Y418H probably damaging Het
Mfng G A 15: 78,773,065 R70C probably damaging Het
Mx2 T A 16: 97,546,883 I236K probably damaging Het
Mysm1 T C 4: 94,965,132 Q410R probably damaging Het
Nlrp12 T C 7: 3,245,400 N100S probably benign Het
Nlrp4b T A 7: 10,725,074 H773Q probably benign Het
Nlrp5 T A 7: 23,423,918 S735T possibly damaging Het
Nt5c2 G A 19: 46,891,581 R363W probably benign Het
Olfr139 T A 11: 74,044,788 H162L possibly damaging Het
Olfr361 A G 2: 37,084,921 F276L possibly damaging Het
Otud7b A T 3: 96,155,211 Y589F probably benign Het
P2rx1 T A 11: 73,009,253 C165* probably null Het
Pax8 T C 2: 24,429,597 D354G possibly damaging Het
Pdcd11 G A 19: 47,106,432 V552I probably benign Het
Pde6c G T 19: 38,159,753 C485F possibly damaging Het
Pex5 T C 6: 124,399,341 Y434C probably benign Het
Ppargc1a T C 5: 51,462,509 probably null Het
Prss2 A T 6: 41,524,952 D224V possibly damaging Het
Psd2 A G 18: 36,002,979 N440S probably benign Het
Psmb3 T A 11: 97,712,439 D159E probably benign Het
Ptgr2 T G 12: 84,307,801 L252R probably damaging Het
Ptpro A T 6: 137,416,820 N829Y probably damaging Het
Rhobtb2 C A 14: 69,796,831 R315L probably benign Het
Rimbp2 A T 5: 128,789,695 V520D possibly damaging Het
Schip1 A T 3: 68,494,578 Y24F probably benign Het
Sdha A T 13: 74,331,436 V432E probably damaging Het
Sez6 T C 11: 77,977,600 L929P probably damaging Het
Shcbp1l A G 1: 153,447,825 I466V probably benign Het
Skor1 T C 9: 63,144,885 S601G probably damaging Het
Slc6a7 A C 18: 61,005,779 L219R probably damaging Het
Smok2a T C 17: 13,225,626 M30T possibly damaging Het
Sp8 A G 12: 118,849,409 D333G probably damaging Het
Spp1 G A 5: 104,440,334 D201N probably damaging Het
Sstr3 A T 15: 78,540,388 L53Q probably damaging Het
Tacc2 T A 7: 130,623,113 N509K probably benign Het
Tdrd1 T C 19: 56,864,377 V1030A probably damaging Het
Tfrc A G 16: 32,619,167 K346R probably benign Het
Tgm3 G A 2: 130,012,410 probably null Het
Tomm5 C A 4: 45,106,651 L88F unknown Het
Trak1 T A 9: 121,416,198 C46* probably null Het
Trim8 A T 19: 46,515,614 D535V probably damaging Het
Trpm7 A T 2: 126,824,075 Y870* probably null Het
Tspoap1 T C 11: 87,764,310 L286P probably benign Het
Ttll3 AAGTA AAGTAGAGTA 6: 113,399,159 probably null Het
Ttn T A 2: 76,732,045 I28819F probably damaging Het
Twf2 T C 9: 106,211,880 S89P probably damaging Het
Ulk4 C T 9: 121,263,668 E168K possibly damaging Het
Unc13b T A 4: 43,172,737 N1188K unknown Het
Utp6 C T 11: 79,937,730 V528I probably benign Het
Vmn1r78 T C 7: 12,153,314 F284S probably benign Het
Vmn2r54 T A 7: 12,632,269 Q246L probably damaging Het
Vmn2r87 A G 10: 130,477,544 M451T probably benign Het
Vwf C T 6: 125,686,520 P2808L Het
Wwc1 T C 11: 35,869,109 Q693R probably benign Het
Zfp658 T A 7: 43,574,684 H794Q possibly damaging Het
Zfp882 A G 8: 71,913,141 D8G probably damaging Het
Other mutations in Eya4
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00435:Eya4 APN 10 23159097 missense probably benign 0.17
IGL00507:Eya4 APN 10 23157536 nonsense probably null
IGL01324:Eya4 APN 10 23116551 critical splice donor site probably null
IGL01350:Eya4 APN 10 23113974 missense possibly damaging 0.88
IGL01397:Eya4 APN 10 23139999 missense probably benign 0.01
IGL02682:Eya4 APN 10 23116600 missense probably damaging 1.00
IGL02688:Eya4 APN 10 23159110 missense probably benign 0.01
IGL03071:Eya4 APN 10 23323073 missense probably benign 0.07
R0420:Eya4 UTSW 10 23155963 missense possibly damaging 0.85
R1688:Eya4 UTSW 10 23123861 missense probably damaging 1.00
R2312:Eya4 UTSW 10 23106264 missense probably damaging 1.00
R3029:Eya4 UTSW 10 23123878 missense probably benign
R3853:Eya4 UTSW 10 23116676 missense probably damaging 1.00
R3872:Eya4 UTSW 10 23155972 missense probably damaging 0.97
R4113:Eya4 UTSW 10 23155951 missense probably damaging 0.98
R4210:Eya4 UTSW 10 23226800 critical splice donor site probably null
R4457:Eya4 UTSW 10 23116668 missense probably damaging 1.00
R4691:Eya4 UTSW 10 23140068 missense probably benign 0.03
R4894:Eya4 UTSW 10 23109854 missense possibly damaging 0.55
R5345:Eya4 UTSW 10 23110048 missense probably benign 0.00
R5473:Eya4 UTSW 10 23163453 missense probably benign 0.02
R5547:Eya4 UTSW 10 23109854 missense possibly damaging 0.55
R5698:Eya4 UTSW 10 23140077 missense possibly damaging 0.50
R5951:Eya4 UTSW 10 23155994 missense probably damaging 1.00
R5953:Eya4 UTSW 10 23151973 missense probably damaging 1.00
R6111:Eya4 UTSW 10 23140055 missense possibly damaging 0.67
R6413:Eya4 UTSW 10 23116826 missense probably damaging 1.00
R6460:Eya4 UTSW 10 23152012 missense probably benign 0.05
R7144:Eya4 UTSW 10 23173045 missense probably benign 0.00
R7169:Eya4 UTSW 10 23155947 missense probably benign 0.42
R7358:Eya4 UTSW 10 23123851 critical splice donor site probably null
R7549:Eya4 UTSW 10 23111658 missense probably damaging 1.00
R7791:Eya4 UTSW 10 23113926 missense probably damaging 1.00
Z1088:Eya4 UTSW 10 23113988 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- TTGCCAGATATGCACTCTATCTGTC -3'
(R):5'- TTGGCAGCTGTTCCTGTGAC -3'

Sequencing Primer
(F):5'- AGATATGCACTCTATCTGTCTATCC -3'
(R):5'- GCAGCTGTTCCTGTGACAATAATG -3'
Posted On2019-11-26