Incidental Mutation 'R7793:Dip2a'
ID600058
Institutional Source Beutler Lab
Gene Symbol Dip2a
Ensembl Gene ENSMUSG00000020231
Gene Namedisco interacting protein 2 homolog A
SynonymsKiaa0184-hp, 4931420H10Rik, Dip2
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R7793 (G1)
Quality Score225.009
Status Validated
Chromosome10
Chromosomal Location76259429-76345291 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to T at 76278583 bp
ZygosityHeterozygous
Amino Acid Change Isoleucine to Asparagine at position 1021 (I1021N)
Ref Sequence ENSEMBL: ENSMUSP00000101057 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000036033] [ENSMUST00000105417] [ENSMUST00000160048] [ENSMUST00000160442]
Predicted Effect probably benign
Transcript: ENSMUST00000036033
AA Change: I1011N

PolyPhen 2 Score 0.067 (Sensitivity: 0.94; Specificity: 0.84)
SMART Domains Protein: ENSMUSP00000043710
Gene: ENSMUSG00000020231
AA Change: I1011N

DomainStartEndE-ValueType
DMAP_binding 9 122 2.55e-35 SMART
low complexity region 173 208 N/A INTRINSIC
low complexity region 281 293 N/A INTRINSIC
Pfam:AMP-binding 330 806 4.3e-26 PFAM
Pfam:AMP-binding 982 1456 1.4e-52 PFAM
low complexity region 1487 1498 N/A INTRINSIC
low complexity region 1511 1532 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000105417
AA Change: I1021N

PolyPhen 2 Score 0.062 (Sensitivity: 0.94; Specificity: 0.84)
SMART Domains Protein: ENSMUSP00000101057
Gene: ENSMUSG00000020231
AA Change: I1021N

DomainStartEndE-ValueType
DMAP_binding 9 122 2.55e-35 SMART
low complexity region 173 208 N/A INTRINSIC
low complexity region 281 293 N/A INTRINSIC
Pfam:AMP-binding 330 806 6.6e-28 PFAM
Pfam:AMP-binding 992 1466 7.3e-65 PFAM
low complexity region 1497 1508 N/A INTRINSIC
low complexity region 1521 1542 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000160048
AA Change: I972N

PolyPhen 2 Score 0.034 (Sensitivity: 0.95; Specificity: 0.82)
SMART Domains Protein: ENSMUSP00000125184
Gene: ENSMUSG00000020231
AA Change: I972N

DomainStartEndE-ValueType
DMAP_binding 9 83 7.94e-23 SMART
low complexity region 134 169 N/A INTRINSIC
low complexity region 242 254 N/A INTRINSIC
Pfam:AMP-binding 291 767 5.3e-26 PFAM
Pfam:AMP-binding 943 1417 1.7e-52 PFAM
low complexity region 1448 1459 N/A INTRINSIC
low complexity region 1472 1493 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000160442
SMART Domains Protein: ENSMUSP00000125744
Gene: ENSMUSG00000020231

DomainStartEndE-ValueType
low complexity region 37 48 N/A INTRINSIC
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.6%
  • 20x: 98.8%
Validation Efficiency 100% (94/94)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene may be involved in axon patterning in the central nervous system. This gene is not highly expressed. Several transcript variants encoding different isoforms have been found for this gene. [provided by RefSeq, Mar 2009]
Allele List at MGI
Other mutations in this stock
Total: 93 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2200002J24Rik T G 7: 30,699,943 I54S probably damaging Het
2310002L09Rik C T 4: 73,942,935 V143M probably benign Het
2610507B11Rik C T 11: 78,273,205 P1124L possibly damaging Het
Abca1 T C 4: 53,042,367 I1902V not run Het
AI314180 T C 4: 58,853,150 N395S probably damaging Het
Apob A C 12: 8,008,124 D2202A probably damaging Het
Arhgap44 T A 11: 65,009,924 S623C probably damaging Het
Arhgef7 T A 8: 11,824,507 W713R possibly damaging Het
Axdnd1 A C 1: 156,338,743 probably null Het
Bcl9l T C 9: 44,508,966 M1223T probably benign Het
Bcl9l C A 9: 44,509,697 H1467N probably damaging Het
Brinp3 A G 1: 146,746,568 N236S probably benign Het
Cckbr T G 7: 105,433,591 L54V probably benign Het
Cd6 G A 19: 10,798,358 Q246* probably null Het
Cep89 G A 7: 35,429,928 R630H probably damaging Het
Ces3a T A 8: 105,055,661 probably null Het
Cgnl1 T A 9: 71,725,635 N145Y probably damaging Het
Col6a5 T C 9: 105,898,735 D1707G probably damaging Het
Cyp2w1 A G 5: 139,356,140 T103A probably damaging Het
Dnah2 T C 11: 69,495,214 T981A probably benign Het
Dnah8 A G 17: 30,855,944 I4546V probably benign Het
E2f8 A C 7: 48,878,075 F106L probably benign Het
Eif4g1 G A 16: 20,688,614 V1413I probably benign Het
Epha10 G A 4: 124,914,453 V688I probably benign Het
Exoc2 A T 13: 30,911,178 V245D probably benign Het
Eya4 T A 10: 23,226,816 E23D probably benign Het
Fbxw10 T A 11: 62,847,387 W36R possibly damaging Het
Gabbr1 G A 17: 37,047,501 G44S probably benign Het
Gabrg3 T A 7: 57,179,580 Q143L probably benign Het
Gm14412 A C 2: 177,315,867 I78M possibly damaging Het
Gm35339 T C 15: 76,359,107 L989P Het
Gm3854 C T 7: 6,353,887 S233L probably damaging Het
Gm7298 T C 6: 121,760,604 probably null Het
Hpse2 A T 19: 43,388,070 L81Q probably damaging Het
Il18r1 A G 1: 40,471,764 H3R probably benign Het
Kansl1l T C 1: 66,778,014 K396E probably damaging Het
Kbtbd3 T A 9: 4,331,221 S532T probably damaging Het
Lrrtm4 T C 6: 80,022,858 Y418H probably damaging Het
Mfng G A 15: 78,773,065 R70C probably damaging Het
Mx2 T A 16: 97,546,883 I236K probably damaging Het
Mysm1 T C 4: 94,965,132 Q410R probably damaging Het
Nlrp12 T C 7: 3,245,400 N100S probably benign Het
Nlrp4b T A 7: 10,725,074 H773Q probably benign Het
Nlrp5 T A 7: 23,423,918 S735T possibly damaging Het
Nt5c2 G A 19: 46,891,581 R363W probably benign Het
Olfr139 T A 11: 74,044,788 H162L possibly damaging Het
Olfr361 A G 2: 37,084,921 F276L possibly damaging Het
Otud7b A T 3: 96,155,211 Y589F probably benign Het
P2rx1 T A 11: 73,009,253 C165* probably null Het
Pax8 T C 2: 24,429,597 D354G possibly damaging Het
Pdcd11 G A 19: 47,106,432 V552I probably benign Het
Pde6c G T 19: 38,159,753 C485F possibly damaging Het
Pex5 T C 6: 124,399,341 Y434C probably benign Het
Ppargc1a T C 5: 51,462,509 probably null Het
Prss2 A T 6: 41,524,952 D224V possibly damaging Het
Psd2 A G 18: 36,002,979 N440S probably benign Het
Psmb3 T A 11: 97,712,439 D159E probably benign Het
Ptgr2 T G 12: 84,307,801 L252R probably damaging Het
Ptpro A T 6: 137,416,820 N829Y probably damaging Het
Rhobtb2 C A 14: 69,796,831 R315L probably benign Het
Rimbp2 A T 5: 128,789,695 V520D possibly damaging Het
Schip1 A T 3: 68,494,578 Y24F probably benign Het
Sdha A T 13: 74,331,436 V432E probably damaging Het
Sez6 T C 11: 77,977,600 L929P probably damaging Het
Shcbp1l A G 1: 153,447,825 I466V probably benign Het
Skor1 T C 9: 63,144,885 S601G probably damaging Het
Slc6a7 A C 18: 61,005,779 L219R probably damaging Het
Smok2a T C 17: 13,225,626 M30T possibly damaging Het
Sp8 A G 12: 118,849,409 D333G probably damaging Het
Spp1 G A 5: 104,440,334 D201N probably damaging Het
Sstr3 A T 15: 78,540,388 L53Q probably damaging Het
Tacc2 T A 7: 130,623,113 N509K probably benign Het
Tdrd1 T C 19: 56,864,377 V1030A probably damaging Het
Tfrc A G 16: 32,619,167 K346R probably benign Het
Tgm3 G A 2: 130,012,410 probably null Het
Tomm5 C A 4: 45,106,651 L88F unknown Het
Trak1 T A 9: 121,416,198 C46* probably null Het
Trim8 A T 19: 46,515,614 D535V probably damaging Het
Trpm7 A T 2: 126,824,075 Y870* probably null Het
Tspoap1 T C 11: 87,764,310 L286P probably benign Het
Ttll3 AAGTA AAGTAGAGTA 6: 113,399,159 probably null Het
Ttn T A 2: 76,732,045 I28819F probably damaging Het
Twf2 T C 9: 106,211,880 S89P probably damaging Het
Ulk4 C T 9: 121,263,668 E168K possibly damaging Het
Unc13b T A 4: 43,172,737 N1188K unknown Het
Utp6 C T 11: 79,937,730 V528I probably benign Het
Vmn1r78 T C 7: 12,153,314 F284S probably benign Het
Vmn2r54 T A 7: 12,632,269 Q246L probably damaging Het
Vmn2r87 A G 10: 130,477,544 M451T probably benign Het
Vwf C T 6: 125,686,520 P2808L Het
Wwc1 T C 11: 35,869,109 Q693R probably benign Het
Zfp658 T A 7: 43,574,684 H794Q possibly damaging Het
Zfp882 A G 8: 71,913,141 D8G probably damaging Het
Other mutations in Dip2a
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00422:Dip2a APN 10 76313236 missense probably benign
IGL00849:Dip2a APN 10 76292318 missense probably damaging 0.99
IGL01685:Dip2a APN 10 76327749 missense probably damaging 1.00
IGL01825:Dip2a APN 10 76272680 nonsense probably null
IGL02343:Dip2a APN 10 76319478 missense probably benign 0.00
IGL02437:Dip2a APN 10 76298267 missense probably benign 0.09
IGL02981:Dip2a APN 10 76276421 missense possibly damaging 0.84
IGL03122:Dip2a APN 10 76275046 missense probably benign 0.00
IGL03261:Dip2a APN 10 76305148 missense possibly damaging 0.80
R0369:Dip2a UTSW 10 76298787 missense probably damaging 1.00
R0522:Dip2a UTSW 10 76321531 missense probably benign 0.03
R0962:Dip2a UTSW 10 76292432 unclassified probably benign
R1164:Dip2a UTSW 10 76276397 missense possibly damaging 0.72
R1309:Dip2a UTSW 10 76279776 missense probably damaging 1.00
R1426:Dip2a UTSW 10 76279820 unclassified probably benign
R1636:Dip2a UTSW 10 76321578 missense probably benign 0.01
R1823:Dip2a UTSW 10 76278502 nonsense probably null
R1830:Dip2a UTSW 10 76317963 missense probably damaging 1.00
R1876:Dip2a UTSW 10 76318091 missense probably damaging 1.00
R2284:Dip2a UTSW 10 76313193 missense probably benign 0.01
R2369:Dip2a UTSW 10 76313196 missense probably benign
R4050:Dip2a UTSW 10 76278607 missense probably damaging 1.00
R4089:Dip2a UTSW 10 76278489 splice site probably null
R4231:Dip2a UTSW 10 76319470 missense probably damaging 1.00
R4715:Dip2a UTSW 10 76296406 missense probably benign 0.34
R4752:Dip2a UTSW 10 76276657 missense probably damaging 1.00
R4846:Dip2a UTSW 10 76321493 missense probably damaging 1.00
R4849:Dip2a UTSW 10 76294533 missense probably damaging 1.00
R4892:Dip2a UTSW 10 76280759 missense probably benign 0.02
R4998:Dip2a UTSW 10 76319556 nonsense probably null
R5068:Dip2a UTSW 10 76318043 missense possibly damaging 0.82
R5141:Dip2a UTSW 10 76270453 missense probably damaging 1.00
R5253:Dip2a UTSW 10 76299997 missense probably damaging 1.00
R5304:Dip2a UTSW 10 76294523 missense possibly damaging 0.67
R5324:Dip2a UTSW 10 76296393 missense probably damaging 1.00
R5369:Dip2a UTSW 10 76292360 missense probably damaging 1.00
R6272:Dip2a UTSW 10 76286407 makesense probably null
R6884:Dip2a UTSW 10 76272532 critical splice donor site probably null
R7143:Dip2a UTSW 10 76297791 missense probably damaging 1.00
R7247:Dip2a UTSW 10 76272532 critical splice donor site probably null
R7252:Dip2a UTSW 10 76273202 missense not run
R7327:Dip2a UTSW 10 76272562 missense probably benign 0.41
R7334:Dip2a UTSW 10 76274246 missense possibly damaging 0.91
R7349:Dip2a UTSW 10 76285592 missense probably damaging 1.00
R7360:Dip2a UTSW 10 76278560 missense probably damaging 1.00
R7513:Dip2a UTSW 10 76313235 missense probably benign
R7794:Dip2a UTSW 10 76276625 missense probably damaging 1.00
R7819:Dip2a UTSW 10 76291028 missense probably benign 0.06
R8079:Dip2a UTSW 10 76287321 missense probably benign
R8280:Dip2a UTSW 10 76264776 missense possibly damaging 0.75
R8281:Dip2a UTSW 10 76276604 missense probably damaging 1.00
Z1088:Dip2a UTSW 10 76285628 missense probably benign 0.06
Z1176:Dip2a UTSW 10 76266323 missense possibly damaging 0.94
Z1176:Dip2a UTSW 10 76280820 missense probably damaging 0.97
Z1177:Dip2a UTSW 10 76266322 missense possibly damaging 0.51
Z1177:Dip2a UTSW 10 76296400 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- GCCAAGAAGCTGACAAGTCC -3'
(R):5'- CTTTCTAGGTTCAGATTGGGCC -3'

Sequencing Primer
(F):5'- TCCACTAGGAACAGAGGTCCTG -3'
(R):5'- TTCAGATTGGGCCACTCAGAG -3'
Posted On2019-11-26