Incidental Mutation 'R7793:Dnah2'
ID600063
Institutional Source Beutler Lab
Gene Symbol Dnah2
Ensembl Gene ENSMUSG00000005237
Gene Namedynein, axonemal, heavy chain 2
SynonymsDnahc2, Dnhd3, D330014H01Rik, 2900022L05Rik
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R7793 (G1)
Quality Score225.009
Status Validated
Chromosome11
Chromosomal Location69420809-69549110 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 69495214 bp
ZygosityHeterozygous
Amino Acid Change Threonine to Alanine at position 981 (T981A)
Ref Sequence ENSEMBL: ENSMUSP00000104299 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000035539] [ENSMUST00000108659]
Predicted Effect probably benign
Transcript: ENSMUST00000035539
AA Change: T981A

PolyPhen 2 Score 0.001 (Sensitivity: 0.99; Specificity: 0.15)
SMART Domains Protein: ENSMUSP00000047329
Gene: ENSMUSG00000005237
AA Change: T981A

DomainStartEndE-ValueType
low complexity region 4 25 N/A INTRINSIC
Pfam:DHC_N1 273 429 6.6e-37 PFAM
Pfam:DHC_N1 432 761 1.3e-54 PFAM
Pfam:DHC_N2 1253 1668 3.4e-144 PFAM
AAA 1826 1962 2.95e-1 SMART
Pfam:AAA_5 2108 2251 1.3e-5 PFAM
AAA 2437 2584 3.63e-5 SMART
Pfam:AAA_8 2752 3022 1.1e-75 PFAM
Pfam:MT 3034 3370 8.7e-55 PFAM
Pfam:AAA_9 3386 3616 7.4e-68 PFAM
Pfam:Dynein_heavy 3748 4453 1.2e-220 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000108659
AA Change: T981A

PolyPhen 2 Score 0.002 (Sensitivity: 0.99; Specificity: 0.30)
SMART Domains Protein: ENSMUSP00000104299
Gene: ENSMUSG00000005237
AA Change: T981A

DomainStartEndE-ValueType
low complexity region 4 25 N/A INTRINSIC
Pfam:DHC_N1 274 429 1.1e-47 PFAM
Pfam:DHC_N1 438 760 1.5e-75 PFAM
Pfam:DHC_N2 1255 1666 4.4e-144 PFAM
low complexity region 1711 1720 N/A INTRINSIC
AAA 1832 1968 2.95e-1 SMART
Blast:AAA 2111 2251 2e-86 BLAST
AAA 2443 2590 3.63e-5 SMART
Pfam:AAA_8 2758 3028 5.5e-77 PFAM
Pfam:MT 3040 3376 7.6e-55 PFAM
Pfam:AAA_9 3396 3621 7.5e-94 PFAM
Pfam:Dynein_heavy 3759 4458 4.9e-264 PFAM
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.6%
  • 20x: 98.8%
Validation Efficiency 100% (94/94)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] Dyneins are microtubule-associated motor protein complexes composed of several heavy, light, and intermediate chains. The axonemal dyneins, found in cilia and flagella, are components of the outer and inner dynein arms attached to the peripheral microtubule doublets. DNAH2 is an axonemal inner arm dynein heavy chain (Chapelin et al., 1997 [PubMed 9256245]).[supplied by OMIM, Mar 2008]
Allele List at MGI
Other mutations in this stock
Total: 93 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2200002J24Rik T G 7: 30,699,943 I54S probably damaging Het
2310002L09Rik C T 4: 73,942,935 V143M probably benign Het
2610507B11Rik C T 11: 78,273,205 P1124L possibly damaging Het
Abca1 T C 4: 53,042,367 I1902V not run Het
AI314180 T C 4: 58,853,150 N395S probably damaging Het
Apob A C 12: 8,008,124 D2202A probably damaging Het
Arhgap44 T A 11: 65,009,924 S623C probably damaging Het
Arhgef7 T A 8: 11,824,507 W713R possibly damaging Het
Axdnd1 A C 1: 156,338,743 probably null Het
Bcl9l T C 9: 44,508,966 M1223T probably benign Het
Bcl9l C A 9: 44,509,697 H1467N probably damaging Het
Brinp3 A G 1: 146,746,568 N236S probably benign Het
Cckbr T G 7: 105,433,591 L54V probably benign Het
Cd6 G A 19: 10,798,358 Q246* probably null Het
Cep89 G A 7: 35,429,928 R630H probably damaging Het
Ces3a T A 8: 105,055,661 probably null Het
Cgnl1 T A 9: 71,725,635 N145Y probably damaging Het
Col6a5 T C 9: 105,898,735 D1707G probably damaging Het
Cyp2w1 A G 5: 139,356,140 T103A probably damaging Het
Dip2a A T 10: 76,278,583 I1021N probably benign Het
Dnah8 A G 17: 30,855,944 I4546V probably benign Het
E2f8 A C 7: 48,878,075 F106L probably benign Het
Eif4g1 G A 16: 20,688,614 V1413I probably benign Het
Epha10 G A 4: 124,914,453 V688I probably benign Het
Exoc2 A T 13: 30,911,178 V245D probably benign Het
Eya4 T A 10: 23,226,816 E23D probably benign Het
Fbxw10 T A 11: 62,847,387 W36R possibly damaging Het
Gabbr1 G A 17: 37,047,501 G44S probably benign Het
Gabrg3 T A 7: 57,179,580 Q143L probably benign Het
Gm14412 A C 2: 177,315,867 I78M possibly damaging Het
Gm35339 T C 15: 76,359,107 L989P Het
Gm3854 C T 7: 6,353,887 S233L probably damaging Het
Gm7298 T C 6: 121,760,604 probably null Het
Hpse2 A T 19: 43,388,070 L81Q probably damaging Het
Il18r1 A G 1: 40,471,764 H3R probably benign Het
Kansl1l T C 1: 66,778,014 K396E probably damaging Het
Kbtbd3 T A 9: 4,331,221 S532T probably damaging Het
Lrrtm4 T C 6: 80,022,858 Y418H probably damaging Het
Mfng G A 15: 78,773,065 R70C probably damaging Het
Mx2 T A 16: 97,546,883 I236K probably damaging Het
Mysm1 T C 4: 94,965,132 Q410R probably damaging Het
Nlrp12 T C 7: 3,245,400 N100S probably benign Het
Nlrp4b T A 7: 10,725,074 H773Q probably benign Het
Nlrp5 T A 7: 23,423,918 S735T possibly damaging Het
Nt5c2 G A 19: 46,891,581 R363W probably benign Het
Olfr139 T A 11: 74,044,788 H162L possibly damaging Het
Olfr361 A G 2: 37,084,921 F276L possibly damaging Het
Otud7b A T 3: 96,155,211 Y589F probably benign Het
P2rx1 T A 11: 73,009,253 C165* probably null Het
Pax8 T C 2: 24,429,597 D354G possibly damaging Het
Pdcd11 G A 19: 47,106,432 V552I probably benign Het
Pde6c G T 19: 38,159,753 C485F possibly damaging Het
Pex5 T C 6: 124,399,341 Y434C probably benign Het
Ppargc1a T C 5: 51,462,509 probably null Het
Prss2 A T 6: 41,524,952 D224V possibly damaging Het
Psd2 A G 18: 36,002,979 N440S probably benign Het
Psmb3 T A 11: 97,712,439 D159E probably benign Het
Ptgr2 T G 12: 84,307,801 L252R probably damaging Het
Ptpro A T 6: 137,416,820 N829Y probably damaging Het
Rhobtb2 C A 14: 69,796,831 R315L probably benign Het
Rimbp2 A T 5: 128,789,695 V520D possibly damaging Het
Schip1 A T 3: 68,494,578 Y24F probably benign Het
Sdha A T 13: 74,331,436 V432E probably damaging Het
Sez6 T C 11: 77,977,600 L929P probably damaging Het
Shcbp1l A G 1: 153,447,825 I466V probably benign Het
Skor1 T C 9: 63,144,885 S601G probably damaging Het
Slc6a7 A C 18: 61,005,779 L219R probably damaging Het
Smok2a T C 17: 13,225,626 M30T possibly damaging Het
Sp8 A G 12: 118,849,409 D333G probably damaging Het
Spp1 G A 5: 104,440,334 D201N probably damaging Het
Sstr3 A T 15: 78,540,388 L53Q probably damaging Het
Tacc2 T A 7: 130,623,113 N509K probably benign Het
Tdrd1 T C 19: 56,864,377 V1030A probably damaging Het
Tfrc A G 16: 32,619,167 K346R probably benign Het
Tgm3 G A 2: 130,012,410 probably null Het
Tomm5 C A 4: 45,106,651 L88F unknown Het
Trak1 T A 9: 121,416,198 C46* probably null Het
Trim8 A T 19: 46,515,614 D535V probably damaging Het
Trpm7 A T 2: 126,824,075 Y870* probably null Het
Tspoap1 T C 11: 87,764,310 L286P probably benign Het
Ttll3 AAGTA AAGTAGAGTA 6: 113,399,159 probably null Het
Ttn T A 2: 76,732,045 I28819F probably damaging Het
Twf2 T C 9: 106,211,880 S89P probably damaging Het
Ulk4 C T 9: 121,263,668 E168K possibly damaging Het
Unc13b T A 4: 43,172,737 N1188K unknown Het
Utp6 C T 11: 79,937,730 V528I probably benign Het
Vmn1r78 T C 7: 12,153,314 F284S probably benign Het
Vmn2r54 T A 7: 12,632,269 Q246L probably damaging Het
Vmn2r87 A G 10: 130,477,544 M451T probably benign Het
Vwf C T 6: 125,686,520 P2808L Het
Wwc1 T C 11: 35,869,109 Q693R probably benign Het
Zfp658 T A 7: 43,574,684 H794Q possibly damaging Het
Zfp882 A G 8: 71,913,141 D8G probably damaging Het
Other mutations in Dnah2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00087:Dnah2 APN 11 69492672 missense possibly damaging 0.93
IGL00418:Dnah2 APN 11 69495066 splice site probably benign
IGL00772:Dnah2 APN 11 69451257 missense probably damaging 0.97
IGL00819:Dnah2 APN 11 69473350 critical splice donor site probably null
IGL00827:Dnah2 APN 11 69448457 missense probably damaging 1.00
IGL01060:Dnah2 APN 11 69478092 missense possibly damaging 0.86
IGL01340:Dnah2 APN 11 69493184 missense probably damaging 0.99
IGL01349:Dnah2 APN 11 69475606 missense probably damaging 0.99
IGL01413:Dnah2 APN 11 69432964 missense probably damaging 0.99
IGL01451:Dnah2 APN 11 69474191 splice site probably benign
IGL01480:Dnah2 APN 11 69458371 missense possibly damaging 0.91
IGL01537:Dnah2 APN 11 69516080 missense probably benign 0.17
IGL01592:Dnah2 APN 11 69431087 missense probably benign 0.14
IGL01612:Dnah2 APN 11 69465063 splice site probably benign
IGL01667:Dnah2 APN 11 69544395 missense probably benign
IGL01667:Dnah2 APN 11 69520941 missense probably damaging 0.98
IGL01691:Dnah2 APN 11 69539443 missense probably benign
IGL02019:Dnah2 APN 11 69474285 missense probably damaging 1.00
IGL02039:Dnah2 APN 11 69499212 missense probably damaging 1.00
IGL02076:Dnah2 APN 11 69422559 missense probably damaging 0.99
IGL02085:Dnah2 APN 11 69458185 missense probably benign 0.07
IGL02158:Dnah2 APN 11 69458123 missense probably benign
IGL02381:Dnah2 APN 11 69446292 missense probably benign 0.25
IGL02681:Dnah2 APN 11 69452933 missense probably benign 0.40
IGL02957:Dnah2 APN 11 69448507 missense possibly damaging 0.96
IGL02961:Dnah2 APN 11 69518414 missense probably damaging 1.00
IGL02969:Dnah2 APN 11 69521187 missense possibly damaging 0.80
IGL03117:Dnah2 APN 11 69436291 splice site probably benign
IGL03120:Dnah2 APN 11 69421848 missense probably damaging 1.00
IGL03183:Dnah2 APN 11 69458488 missense possibly damaging 0.94
IGL03197:Dnah2 APN 11 69459263 missense probably damaging 1.00
IGL03263:Dnah2 APN 11 69529381 critical splice donor site probably null
IGL03333:Dnah2 APN 11 69495123 missense probably damaging 1.00
IGL03338:Dnah2 APN 11 69496577 missense probably benign 0.13
argyrios UTSW 11 69516590 missense possibly damaging 0.47
Aureus UTSW 11 69429348 missense probably damaging 1.00
platinum UTSW 11 69458042 missense probably damaging 0.96
E0370:Dnah2 UTSW 11 69515615 splice site probably null
P0026:Dnah2 UTSW 11 69464947 missense probably damaging 1.00
R0133:Dnah2 UTSW 11 69421009 missense probably damaging 1.00
R0190:Dnah2 UTSW 11 69435249 missense probably damaging 1.00
R0334:Dnah2 UTSW 11 69436836 missense probably damaging 1.00
R0359:Dnah2 UTSW 11 69529531 missense probably benign 0.00
R0386:Dnah2 UTSW 11 69447861 missense probably damaging 1.00
R0414:Dnah2 UTSW 11 69499238 missense probably benign 0.26
R0427:Dnah2 UTSW 11 69452879 missense probably damaging 0.99
R0433:Dnah2 UTSW 11 69459288 missense probably damaging 1.00
R0442:Dnah2 UTSW 11 69448542 missense probably damaging 1.00
R0462:Dnah2 UTSW 11 69459201 missense probably damaging 1.00
R0463:Dnah2 UTSW 11 69423126 missense probably damaging 1.00
R0611:Dnah2 UTSW 11 69499194 missense probably damaging 1.00
R0626:Dnah2 UTSW 11 69477683 missense probably benign 0.07
R0924:Dnah2 UTSW 11 69421308 missense probably damaging 1.00
R0968:Dnah2 UTSW 11 69448519 missense possibly damaging 0.67
R1066:Dnah2 UTSW 11 69447819 missense probably damaging 1.00
R1183:Dnah2 UTSW 11 69446648 missense possibly damaging 0.95
R1184:Dnah2 UTSW 11 69499190 missense probably damaging 1.00
R1186:Dnah2 UTSW 11 69515700 missense probably damaging 0.99
R1453:Dnah2 UTSW 11 69451050 missense probably damaging 0.99
R1498:Dnah2 UTSW 11 69520667 intron probably null
R1538:Dnah2 UTSW 11 69477202 missense probably benign 0.17
R1574:Dnah2 UTSW 11 69514688 missense probably benign 0.26
R1574:Dnah2 UTSW 11 69514688 missense probably benign 0.26
R1590:Dnah2 UTSW 11 69422754 critical splice donor site probably null
R1590:Dnah2 UTSW 11 69521198 missense probably benign 0.00
R1655:Dnah2 UTSW 11 69473854 missense probably damaging 1.00
R1695:Dnah2 UTSW 11 69514691 missense possibly damaging 0.74
R1726:Dnah2 UTSW 11 69497889 missense probably damaging 1.00
R1764:Dnah2 UTSW 11 69423543 missense probably damaging 1.00
R1815:Dnah2 UTSW 11 69475574 missense probably damaging 1.00
R1822:Dnah2 UTSW 11 69514804 missense probably damaging 1.00
R1859:Dnah2 UTSW 11 69437886 missense probably damaging 0.99
R1911:Dnah2 UTSW 11 69515752 missense possibly damaging 0.64
R1913:Dnah2 UTSW 11 69464930 missense probably damaging 1.00
R1981:Dnah2 UTSW 11 69474325 missense probably damaging 1.00
R2010:Dnah2 UTSW 11 69458358 critical splice donor site probably null
R2016:Dnah2 UTSW 11 69437070 missense probably damaging 0.97
R2017:Dnah2 UTSW 11 69437070 missense probably damaging 0.97
R2044:Dnah2 UTSW 11 69524240 missense probably benign 0.14
R2077:Dnah2 UTSW 11 69496606 missense possibly damaging 0.73
R2096:Dnah2 UTSW 11 69455916 missense probably damaging 0.98
R2099:Dnah2 UTSW 11 69493237 missense probably damaging 1.00
R2127:Dnah2 UTSW 11 69458185 missense probably benign 0.02
R2128:Dnah2 UTSW 11 69458185 missense probably benign 0.02
R2146:Dnah2 UTSW 11 69515761 missense probably benign 0.14
R2147:Dnah2 UTSW 11 69515761 missense probably benign 0.14
R2150:Dnah2 UTSW 11 69515761 missense probably benign 0.14
R2404:Dnah2 UTSW 11 69437221 missense probably damaging 0.99
R2510:Dnah2 UTSW 11 69524206 nonsense probably null
R2517:Dnah2 UTSW 11 69516644 missense probably damaging 1.00
R3014:Dnah2 UTSW 11 69430478 missense probably benign
R3741:Dnah2 UTSW 11 69448469 missense probably damaging 1.00
R3814:Dnah2 UTSW 11 69492650 splice site probably null
R3872:Dnah2 UTSW 11 69429348 missense probably damaging 1.00
R3873:Dnah2 UTSW 11 69429348 missense probably damaging 1.00
R3874:Dnah2 UTSW 11 69429348 missense probably damaging 1.00
R3875:Dnah2 UTSW 11 69429348 missense probably damaging 1.00
R3881:Dnah2 UTSW 11 69451347 missense possibly damaging 0.94
R3953:Dnah2 UTSW 11 69454103 missense probably damaging 1.00
R3956:Dnah2 UTSW 11 69484021 missense probably benign 0.00
R4501:Dnah2 UTSW 11 69477659 missense probably benign
R4515:Dnah2 UTSW 11 69465631 missense possibly damaging 0.61
R4612:Dnah2 UTSW 11 69483367 missense possibly damaging 0.93
R4625:Dnah2 UTSW 11 69463661 missense probably damaging 1.00
R4627:Dnah2 UTSW 11 69465376 missense probably damaging 1.00
R4642:Dnah2 UTSW 11 69496559 missense probably benign 0.00
R4683:Dnah2 UTSW 11 69458942 missense probably damaging 1.00
R4698:Dnah2 UTSW 11 69498532 missense probably damaging 1.00
R4710:Dnah2 UTSW 11 69478077 missense probably damaging 1.00
R4712:Dnah2 UTSW 11 69516590 missense possibly damaging 0.47
R4713:Dnah2 UTSW 11 69476688 missense probably damaging 1.00
R4717:Dnah2 UTSW 11 69429357 missense probably benign 0.00
R4740:Dnah2 UTSW 11 69458042 missense probably damaging 0.96
R4780:Dnah2 UTSW 11 69473871 missense probably damaging 0.97
R4825:Dnah2 UTSW 11 69423205 missense probably damaging 1.00
R4864:Dnah2 UTSW 11 69422590 missense probably damaging 0.98
R4868:Dnah2 UTSW 11 69463648 missense probably damaging 1.00
R4879:Dnah2 UTSW 11 69476691 missense probably damaging 1.00
R4908:Dnah2 UTSW 11 69521147 missense probably benign 0.00
R4911:Dnah2 UTSW 11 69499104 critical splice donor site probably null
R4954:Dnah2 UTSW 11 69539496 missense possibly damaging 0.61
R4962:Dnah2 UTSW 11 69455973 nonsense probably null
R5015:Dnah2 UTSW 11 69497882 missense possibly damaging 0.89
R5049:Dnah2 UTSW 11 69448166 missense probably damaging 1.00
R5055:Dnah2 UTSW 11 69520773 missense possibly damaging 0.67
R5153:Dnah2 UTSW 11 69520933 missense possibly damaging 0.84
R5155:Dnah2 UTSW 11 69422536 missense probably damaging 1.00
R5186:Dnah2 UTSW 11 69435884 missense probably damaging 1.00
R5187:Dnah2 UTSW 11 69458920 missense probably benign 0.15
R5208:Dnah2 UTSW 11 69458920 missense probably benign 0.15
R5252:Dnah2 UTSW 11 69529469 missense probably damaging 0.98
R5296:Dnah2 UTSW 11 69458920 missense probably benign 0.15
R5298:Dnah2 UTSW 11 69458920 missense probably benign 0.15
R5299:Dnah2 UTSW 11 69458920 missense probably benign 0.15
R5301:Dnah2 UTSW 11 69458920 missense probably benign 0.15
R5324:Dnah2 UTSW 11 69457993 missense probably benign 0.07
R5350:Dnah2 UTSW 11 69516036 missense possibly damaging 0.48
R5377:Dnah2 UTSW 11 69421848 missense probably damaging 1.00
R5393:Dnah2 UTSW 11 69500857 missense probably benign
R5421:Dnah2 UTSW 11 69435636 missense probably damaging 1.00
R5452:Dnah2 UTSW 11 69524383 missense probably damaging 1.00
R5461:Dnah2 UTSW 11 69473351 critical splice donor site probably null
R5474:Dnah2 UTSW 11 69458920 missense probably benign 0.15
R5476:Dnah2 UTSW 11 69458920 missense probably benign 0.15
R5477:Dnah2 UTSW 11 69458920 missense probably benign 0.15
R5510:Dnah2 UTSW 11 69458920 missense probably benign 0.15
R5527:Dnah2 UTSW 11 69437188 nonsense probably null
R5566:Dnah2 UTSW 11 69516569 nonsense probably null
R5587:Dnah2 UTSW 11 69437242 missense probably damaging 1.00
R5628:Dnah2 UTSW 11 69458920 missense probably benign 0.15
R5688:Dnah2 UTSW 11 69458920 missense probably benign 0.15
R5690:Dnah2 UTSW 11 69491544 missense probably benign 0.15
R5711:Dnah2 UTSW 11 69435390 missense probably damaging 1.00
R5735:Dnah2 UTSW 11 69430817 missense possibly damaging 0.93
R5826:Dnah2 UTSW 11 69458920 missense probably benign 0.15
R5913:Dnah2 UTSW 11 69448430 missense probably damaging 1.00
R5914:Dnah2 UTSW 11 69458920 missense probably benign 0.15
R5960:Dnah2 UTSW 11 69458920 missense probably benign 0.15
R5961:Dnah2 UTSW 11 69431148 missense probably damaging 1.00
R5961:Dnah2 UTSW 11 69458920 missense probably benign 0.15
R5977:Dnah2 UTSW 11 69520881 missense possibly damaging 0.79
R6020:Dnah2 UTSW 11 69500839 missense probably benign
R6036:Dnah2 UTSW 11 69458920 missense probably benign 0.15
R6036:Dnah2 UTSW 11 69458920 missense probably benign 0.15
R6050:Dnah2 UTSW 11 69458920 missense probably benign 0.15
R6086:Dnah2 UTSW 11 69516008 missense probably benign 0.30
R6115:Dnah2 UTSW 11 69446649 missense probably damaging 1.00
R6123:Dnah2 UTSW 11 69518359 missense probably benign 0.29
R6159:Dnah2 UTSW 11 69458542 missense probably damaging 1.00
R6159:Dnah2 UTSW 11 69458920 missense probably benign 0.15
R6163:Dnah2 UTSW 11 69520903 nonsense probably null
R6171:Dnah2 UTSW 11 69423042 missense probably damaging 1.00
R6263:Dnah2 UTSW 11 69457412 missense probably damaging 1.00
R6298:Dnah2 UTSW 11 69491641 missense probably benign 0.25
R6352:Dnah2 UTSW 11 69448227 missense probably damaging 1.00
R6399:Dnah2 UTSW 11 69458518 missense probably damaging 0.98
R6466:Dnah2 UTSW 11 69539415 missense probably benign
R6478:Dnah2 UTSW 11 69516010 missense probably benign 0.01
R6516:Dnah2 UTSW 11 69465386 missense probably benign 0.34
R6538:Dnah2 UTSW 11 69437197 missense possibly damaging 0.87
R6802:Dnah2 UTSW 11 69423690 missense probably damaging 1.00
R6861:Dnah2 UTSW 11 69455963 missense possibly damaging 0.64
R6869:Dnah2 UTSW 11 69429471 missense probably damaging 1.00
R6894:Dnah2 UTSW 11 69484260 missense probably benign 0.12
R6935:Dnah2 UTSW 11 69421741 missense probably damaging 1.00
R7017:Dnah2 UTSW 11 69491547 nonsense probably null
R7073:Dnah2 UTSW 11 69430492 nonsense probably null
R7111:Dnah2 UTSW 11 69446753 splice site probably null
R7125:Dnah2 UTSW 11 69436182 missense probably damaging 0.99
R7137:Dnah2 UTSW 11 69491555 missense probably damaging 1.00
R7190:Dnah2 UTSW 11 69549097 utr 5 prime probably null
R7214:Dnah2 UTSW 11 69431109 missense probably damaging 1.00
R7227:Dnah2 UTSW 11 69421396 missense probably damaging 0.99
R7238:Dnah2 UTSW 11 69459146 critical splice donor site probably null
R7256:Dnah2 UTSW 11 69431094 missense probably damaging 1.00
R7267:Dnah2 UTSW 11 69500817 missense probably damaging 1.00
R7420:Dnah2 UTSW 11 69478797 missense possibly damaging 0.94
R7421:Dnah2 UTSW 11 69492805 missense probably benign 0.25
R7437:Dnah2 UTSW 11 69498627 missense probably damaging 1.00
R7461:Dnah2 UTSW 11 69548990 critical splice donor site probably null
R7473:Dnah2 UTSW 11 69491658 missense probably damaging 0.99
R7528:Dnah2 UTSW 11 69500796 missense probably damaging 0.99
R7613:Dnah2 UTSW 11 69548990 critical splice donor site probably null
R7615:Dnah2 UTSW 11 69435304 missense probably damaging 0.99
R7626:Dnah2 UTSW 11 69498685 missense probably damaging 0.99
R7745:Dnah2 UTSW 11 69451318 nonsense probably null
R7764:Dnah2 UTSW 11 69458158 missense probably benign 0.29
R7819:Dnah2 UTSW 11 69516593 missense probably benign 0.01
R7881:Dnah2 UTSW 11 69431238 missense probably damaging 1.00
R7900:Dnah2 UTSW 11 69518428 missense probably damaging 1.00
R7942:Dnah2 UTSW 11 69476596 intron probably null
R7964:Dnah2 UTSW 11 69431238 missense probably damaging 1.00
R7983:Dnah2 UTSW 11 69518428 missense probably damaging 1.00
R7995:Dnah2 UTSW 11 69520737 missense possibly damaging 0.77
R8202:Dnah2 UTSW 11 69478823 missense probably benign 0.00
R8208:Dnah2 UTSW 11 69520852 missense probably benign 0.05
R8215:Dnah2 UTSW 11 69435367 missense probably damaging 1.00
RF004:Dnah2 UTSW 11 69437187 missense probably benign 0.24
U24488:Dnah2 UTSW 11 69483822 missense probably damaging 0.99
X0021:Dnah2 UTSW 11 69448562 missense possibly damaging 0.81
Z1088:Dnah2 UTSW 11 69430793 missense probably damaging 1.00
Z1176:Dnah2 UTSW 11 69421821 missense possibly damaging 0.46
Z1176:Dnah2 UTSW 11 69451120 missense probably benign
Z1176:Dnah2 UTSW 11 69487054 missense possibly damaging 0.46
Z1176:Dnah2 UTSW 11 69498667 missense probably benign 0.12
Z1176:Dnah2 UTSW 11 69516481 missense probably damaging 1.00
Z1176:Dnah2 UTSW 11 69516523 missense probably damaging 1.00
Z1177:Dnah2 UTSW 11 69463453 missense possibly damaging 0.63
Z1177:Dnah2 UTSW 11 69544557 critical splice acceptor site probably null
Predicted Primers PCR Primer
(F):5'- CAGTGAGCCCTGTACTTAGATAC -3'
(R):5'- ACAGGTCCTCTTATCCCCTGAG -3'

Sequencing Primer
(F):5'- GTACTTAGATACTCACCGGGCAATG -3'
(R):5'- ACAAGTTTCCCAGTGCTCATG -3'
Posted On2019-11-26