Mutagenetix > Incidental Mutation

Incidental Mutation 'R7793:Exoc2'

600074

Institutional Source

Beutler Lab

Gene Symbol

Exoc2

Ensembl Gene

ENSMUSG00000021357

Gene Name

exocyst complex component 2

Synonyms

2410030I24Rik, Sec5l1, Sec5

MMRRC Submission

Accession Numbers

Essential gene?

Probably essential (E-score: 0.956) question?

Stock #

R7793 (G1)

Quality Score

225.009

Status

Validated

Chromosome

Chromosomal Location

30813919-30974093 bp(-) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

A to T at 30911178 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Valine to Aspartic acid at position 245 (V245D)

Ref Sequence

ENSEMBL: ENSMUSP00000021785 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000021785] [ENSMUST00000102946]

AlphaFold

Q9D4H1

PDB Structure

RAL BINDING DOMAIN FROM SEC5 [SOLUTION NMR]

Predicted Effect

probably benign
Transcript: ENSMUST00000021785
AA Change: V245D

PolyPhen 2 Score 0.003 (Sensitivity: 0.98; Specificity: 0.44)

SMART Domains

Protein: ENSMUSP00000021785
Gene: ENSMUSG00000021357
AA Change: V245D

Domain	Start	End	E-Value	Type
Pfam:TIG	8	92	3.2e-10	PFAM
Pfam:Sec5	198	377	3.6e-59	PFAM
low complexity region	572	585	N/A	INTRINSIC

Predicted Effect

probably benign
Transcript: ENSMUST00000102946
AA Change: V245D

PolyPhen 2 Score 0.003 (Sensitivity: 0.98; Specificity: 0.44)

SMART Domains

Protein: ENSMUSP00000100010
Gene: ENSMUSG00000021357
AA Change: V245D

Domain	Start	End	E-Value	Type
Pfam:TIG	8	92	2.5e-10	PFAM
Pfam:Sec5	198	377	7.5e-59	PFAM
low complexity region	572	585	N/A	INTRINSIC

Coding Region Coverage

1x: 100.0%
3x: 99.9%
10x: 99.6%
20x: 98.8%

Validation Efficiency

100% (94/94)

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene is a component of the exocyst complex, a multi-protein complex essential for the polarized targeting of exocytic vesicles to specific docking sites on the plasma membrane. Though best characterized in yeast, the component proteins and the functions of the exocyst complex have been demonstrated to be highly conserved in higher eukaryotes. At least eight components of the exocyst complex, including this protein, are found to interact with the actin cytoskeletal remodeling and vesicle transport machinery. This interaction has been shown to mediate filopodia formation in fibroblasts. This protein has been shown to interact with the Ral subfamily of GTPases and thereby mediate exocytosis by tethering vesicles to the plasma membrane. Alternative splicing results in multiple transcript variants. [provided by RefSeq, Jul 2012]

Allele List at MGI

Other mutations in this stock

Total: 93 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
2200002J24Rik	T	G	7: 30,699,943	I54S	probably damaging	Het
2310002L09Rik	C	T	4: 73,942,935	V143M	probably benign	Het
2610507B11Rik	C	T	11: 78,273,205	P1124L	possibly damaging	Het
Abca1	T	C	4: 53,042,367	I1902V	not run	Het
AI314180	T	C	4: 58,853,150	N395S	probably damaging	Het
Apob	A	C	12: 8,008,124	D2202A	probably damaging	Het
Arhgap44	T	A	11: 65,009,924	S623C	probably damaging	Het
Arhgef7	T	A	8: 11,824,507	W713R	possibly damaging	Het
Axdnd1	A	C	1: 156,338,743		probably null	Het
Bcl9l	T	C	9: 44,508,966	M1223T	probably benign	Het
Bcl9l	C	A	9: 44,509,697	H1467N	probably damaging	Het
Brinp3	A	G	1: 146,746,568	N236S	probably benign	Het
Cckbr	T	G	7: 105,433,591	L54V	probably benign	Het
Cd6	G	A	19: 10,798,358	Q246*	probably null	Het
Cep89	G	A	7: 35,429,928	R630H	probably damaging	Het
Ces3a	T	A	8: 105,055,661		probably null	Het
Cgnl1	T	A	9: 71,725,635	N145Y	probably damaging	Het
Col6a5	T	C	9: 105,898,735	D1707G	probably damaging	Het
Cyp2w1	A	G	5: 139,356,140	T103A	probably damaging	Het
Dip2a	A	T	10: 76,278,583	I1021N	probably benign	Het
Dnah2	T	C	11: 69,495,214	T981A	probably benign	Het
Dnah8	A	G	17: 30,855,944	I4546V	probably benign	Het
E2f8	A	C	7: 48,878,075	F106L	probably benign	Het
Eif4g1	G	A	16: 20,688,614	V1413I	probably benign	Het
Epha10	G	A	4: 124,914,453	V688I	probably benign	Het
Eya4	T	A	10: 23,226,816	E23D	probably benign	Het
Fbxw10	T	A	11: 62,847,387	W36R	possibly damaging	Het
Gabbr1	G	A	17: 37,047,501	G44S	probably benign	Het
Gabrg3	T	A	7: 57,179,580	Q143L	probably benign	Het
Gm14412	A	C	2: 177,315,867	I78M	possibly damaging	Het
Gm35339	T	C	15: 76,359,107	L989P		Het
Gm3854	C	T	7: 6,353,887	S233L	probably damaging	Het
Gm7298	T	C	6: 121,760,604		probably null	Het
Hpse2	A	T	19: 43,388,070	L81Q	probably damaging	Het
Il18r1	A	G	1: 40,471,764	H3R	probably benign	Het
Kansl1l	T	C	1: 66,778,014	K396E	probably damaging	Het
Kbtbd3	T	A	9: 4,331,221	S532T	probably damaging	Het
Lrrtm4	T	C	6: 80,022,858	Y418H	probably damaging	Het
Mfng	G	A	15: 78,773,065	R70C	probably damaging	Het
Mx2	T	A	16: 97,546,883	I236K	probably damaging	Het
Mysm1	T	C	4: 94,965,132	Q410R	probably damaging	Het
Nlrp12	T	C	7: 3,245,400	N100S	probably benign	Het
Nlrp4b	T	A	7: 10,725,074	H773Q	probably benign	Het
Nlrp5	T	A	7: 23,423,918	S735T	possibly damaging	Het
Nt5c2	G	A	19: 46,891,581	R363W	probably benign	Het
Olfr139	T	A	11: 74,044,788	H162L	possibly damaging	Het
Olfr361	A	G	2: 37,084,921	F276L	possibly damaging	Het
Otud7b	A	T	3: 96,155,211	Y589F	probably benign	Het
P2rx1	T	A	11: 73,009,253	C165*	probably null	Het
Pax8	T	C	2: 24,429,597	D354G	possibly damaging	Het
Pdcd11	G	A	19: 47,106,432	V552I	probably benign	Het
Pde6c	G	T	19: 38,159,753	C485F	possibly damaging	Het
Pex5	T	C	6: 124,399,341	Y434C	probably benign	Het
Ppargc1a	T	C	5: 51,462,509		probably null	Het
Prss2	A	T	6: 41,524,952	D224V	possibly damaging	Het
Psd2	A	G	18: 36,002,979	N440S	probably benign	Het
Psmb3	T	A	11: 97,712,439	D159E	probably benign	Het
Ptgr2	T	G	12: 84,307,801	L252R	probably damaging	Het
Ptpro	A	T	6: 137,416,820	N829Y	probably damaging	Het
Rhobtb2	C	A	14: 69,796,831	R315L	probably benign	Het
Rimbp2	A	T	5: 128,789,695	V520D	possibly damaging	Het
Schip1	A	T	3: 68,494,578	Y24F	probably benign	Het
Sdha	A	T	13: 74,331,436	V432E	probably damaging	Het
Sez6	T	C	11: 77,977,600	L929P	probably damaging	Het
Shcbp1l	A	G	1: 153,447,825	I466V	probably benign	Het
Skor1	T	C	9: 63,144,885	S601G	probably damaging	Het
Slc6a7	A	C	18: 61,005,779	L219R	probably damaging	Het
Smok2a	T	C	17: 13,225,626	M30T	possibly damaging	Het
Sp8	A	G	12: 118,849,409	D333G	probably damaging	Het
Spp1	G	A	5: 104,440,334	D201N	probably damaging	Het
Sstr3	A	T	15: 78,540,388	L53Q	probably damaging	Het
Tacc2	T	A	7: 130,623,113	N509K	probably benign	Het
Tdrd1	T	C	19: 56,864,377	V1030A	probably damaging	Het
Tfrc	A	G	16: 32,619,167	K346R	probably benign	Het
Tgm3	G	A	2: 130,012,410		probably null	Het
Tomm5	C	A	4: 45,106,651	L88F	unknown	Het
Trak1	T	A	9: 121,416,198	C46*	probably null	Het
Trim8	A	T	19: 46,515,614	D535V	probably damaging	Het
Trpm7	A	T	2: 126,824,075	Y870*	probably null	Het
Tspoap1	T	C	11: 87,764,310	L286P	probably benign	Het
Ttll3	AAGTA	AAGTAGAGTA	6: 113,399,159		probably null	Het
Ttn	T	A	2: 76,732,045	I28819F	probably damaging	Het
Twf2	T	C	9: 106,211,880	S89P	probably damaging	Het
Ulk4	C	T	9: 121,263,668	E168K	possibly damaging	Het
Unc13b	T	A	4: 43,172,737	N1188K	unknown	Het
Utp6	C	T	11: 79,937,730	V528I	probably benign	Het
Vmn1r78	T	C	7: 12,153,314	F284S	probably benign	Het
Vmn2r54	T	A	7: 12,632,269	Q246L	probably damaging	Het
Vmn2r87	A	G	10: 130,477,544	M451T	probably benign	Het
Vwf	C	T	6: 125,686,520	P2808L		Het
Wwc1	T	C	11: 35,869,109	Q693R	probably benign	Het
Zfp658	T	A	7: 43,574,684	H794Q	possibly damaging	Het
Zfp882	A	G	8: 71,913,141	D8G	probably damaging	Het

Other mutations in Exoc2

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00095:Exoc2	APN	13	30820626	missense	probably benign	0.17
IGL01839:Exoc2	APN	13	30906799	missense	probably damaging	1.00
IGL02092:Exoc2	APN	13	30875277	missense	probably benign	0.09
IGL02245:Exoc2	APN	13	30906859	missense	probably benign	0.10
IGL02267:Exoc2	APN	13	30815321	missense	probably benign
IGL02478:Exoc2	APN	13	30927420	missense	probably benign
IGL02500:Exoc2	APN	13	30911196	missense	probably damaging	1.00
IGL03081:Exoc2	APN	13	30900902	missense	probably benign	0.28
IGL03112:Exoc2	APN	13	30906587	splice site	probably benign
IGL03409:Exoc2	APN	13	30940737	utr 5 prime	probably benign
R0284:Exoc2	UTSW	13	30877625	splice site	probably benign
R0452:Exoc2	UTSW	13	30886327	splice site	probably benign
R0826:Exoc2	UTSW	13	30856797	critical splice acceptor site	probably null
R1251:Exoc2	UTSW	13	30886276	missense	probably benign	0.03
R1367:Exoc2	UTSW	13	30882273	nonsense	probably null
R1501:Exoc2	UTSW	13	30935502	missense	probably benign	0.01
R1593:Exoc2	UTSW	13	30856761	missense	possibly damaging	0.64
R1839:Exoc2	UTSW	13	30906497	splice site	probably benign
R1872:Exoc2	UTSW	13	30822661	missense	probably benign	0.17
R2064:Exoc2	UTSW	13	30935561	missense	probably benign	0.00
R2070:Exoc2	UTSW	13	30815370	missense	probably benign	0.00
R2227:Exoc2	UTSW	13	30864884	missense	probably benign
R2507:Exoc2	UTSW	13	30882365	missense	possibly damaging	0.55
R3965:Exoc2	UTSW	13	30877582	missense	probably benign	0.00
R4601:Exoc2	UTSW	13	30882268	missense	probably benign	0.05
R4914:Exoc2	UTSW	13	30876813	missense	probably benign	0.21
R5299:Exoc2	UTSW	13	30871918	splice site	probably null
R5410:Exoc2	UTSW	13	30864856	missense	probably damaging	0.98
R5461:Exoc2	UTSW	13	30925755	missense	possibly damaging	0.66
R5956:Exoc2	UTSW	13	30820623	missense	probably benign	0.03
R6056:Exoc2	UTSW	13	30900829	missense	probably benign	0.03
R6107:Exoc2	UTSW	13	30876797	missense	probably benign
R6548:Exoc2	UTSW	13	30826064	missense	possibly damaging	0.86
R6692:Exoc2	UTSW	13	30935507	missense	probably benign	0.09
R6969:Exoc2	UTSW	13	30911178	missense	probably benign
R7386:Exoc2	UTSW	13	30906663	splice site	probably null
R7461:Exoc2	UTSW	13	30882272	missense	probably benign	0.32
R7467:Exoc2	UTSW	13	30925733	missense	probably damaging	0.98
R7473:Exoc2	UTSW	13	30822630	critical splice donor site	probably null
R7613:Exoc2	UTSW	13	30882272	missense	probably benign	0.32
R7767:Exoc2	UTSW	13	30876769	missense	probably benign	0.01
R7795:Exoc2	UTSW	13	30876773	nonsense	probably null
R7993:Exoc2	UTSW	13	30906730	critical splice donor site	probably null
R8085:Exoc2	UTSW	13	30940703	missense	probably damaging	1.00
R8330:Exoc2	UTSW	13	30877573	missense	probably benign
R8716:Exoc2	UTSW	13	30911244	missense	probably damaging	1.00
R8735:Exoc2	UTSW	13	30906839	missense	probably damaging	1.00
R8922:Exoc2	UTSW	13	30871855	missense	probably benign	0.05
R9237:Exoc2	UTSW	13	30864875	missense	probably benign
R9243:Exoc2	UTSW	13	30925795	missense	probably benign	0.03
R9365:Exoc2	UTSW	13	30856714	missense	probably benign	0.00
R9731:Exoc2	UTSW	13	30877250	missense	probably benign	0.06

Predicted Primers

PCR Primer
(F):5'- GTTTCCAGGTAGCAAATTACAGTTC -3'
(R):5'- TCATCTGTGTTTTCCCAGAATGTTG -3'

Sequencing Primer
(F):5'- CCAGGTAGCAAATTACAGTTCTTGAG -3'
(R):5'- TCCTCTTGAATGGTGAAAATAATAGG -3'

Posted On

2019-11-26