Incidental Mutation 'R7793:Eif4g1'
ID600080
Institutional Source Beutler Lab
Gene Symbol Eif4g1
Ensembl Gene ENSMUSG00000045983
Gene Nameeukaryotic translation initiation factor 4, gamma 1
SynonymsE030015G23Rik
Accession Numbers
Is this an essential gene? Probably essential (E-score: 0.967) question?
Stock #R7793 (G1)
Quality Score225.009
Status Validated
Chromosome16
Chromosomal Location20668313-20692884 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) G to A at 20688614 bp
ZygosityHeterozygous
Amino Acid Change Valine to Isoleucine at position 1413 (V1413I)
Ref Sequence ENSEMBL: ENSMUSP00000047678 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000044783] [ENSMUST00000073840] [ENSMUST00000115457] [ENSMUST00000115460] [ENSMUST00000115461] [ENSMUST00000115463] [ENSMUST00000118919] [ENSMUST00000128594] [ENSMUST00000142344] [ENSMUST00000143939] [ENSMUST00000149543] [ENSMUST00000150333] [ENSMUST00000156226] [ENSMUST00000232207]
Predicted Effect probably benign
Transcript: ENSMUST00000044783
AA Change: V1413I

PolyPhen 2 Score 0.001 (Sensitivity: 0.99; Specificity: 0.15)
SMART Domains Protein: ENSMUSP00000047678
Gene: ENSMUSG00000045983
AA Change: V1413I

DomainStartEndE-ValueType
low complexity region 60 81 N/A INTRINSIC
PDB:1LJ2|D 179 206 1e-10 PDB
low complexity region 260 286 N/A INTRINSIC
low complexity region 436 457 N/A INTRINSIC
low complexity region 464 487 N/A INTRINSIC
Blast:MIF4G 638 683 7e-9 BLAST
low complexity region 685 707 N/A INTRINSIC
MIF4G 765 993 5.14e-72 SMART
low complexity region 1035 1047 N/A INTRINSIC
low complexity region 1092 1106 N/A INTRINSIC
low complexity region 1157 1178 N/A INTRINSIC
low complexity region 1186 1201 N/A INTRINSIC
MA3 1242 1354 3.83e-39 SMART
low complexity region 1441 1452 N/A INTRINSIC
eIF5C 1508 1595 3.78e-33 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000073840
AA Change: V1406I

PolyPhen 2 Score 0.001 (Sensitivity: 0.99; Specificity: 0.15)
SMART Domains Protein: ENSMUSP00000073506
Gene: ENSMUSG00000045983
AA Change: V1406I

DomainStartEndE-ValueType
low complexity region 53 74 N/A INTRINSIC
PDB:1LJ2|D 172 199 1e-10 PDB
low complexity region 253 279 N/A INTRINSIC
low complexity region 429 450 N/A INTRINSIC
low complexity region 457 480 N/A INTRINSIC
Blast:MIF4G 631 676 7e-9 BLAST
low complexity region 678 700 N/A INTRINSIC
MIF4G 758 986 5.14e-72 SMART
low complexity region 1028 1040 N/A INTRINSIC
low complexity region 1085 1099 N/A INTRINSIC
low complexity region 1150 1171 N/A INTRINSIC
low complexity region 1179 1194 N/A INTRINSIC
MA3 1235 1347 3.83e-39 SMART
low complexity region 1434 1445 N/A INTRINSIC
eIF5C 1501 1588 3.78e-33 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000115457
AA Change: V1366I

PolyPhen 2 Score 0.001 (Sensitivity: 0.99; Specificity: 0.15)
SMART Domains Protein: ENSMUSP00000111117
Gene: ENSMUSG00000045983
AA Change: V1366I

DomainStartEndE-ValueType
low complexity region 13 34 N/A INTRINSIC
PDB:1LJ2|D 132 159 9e-11 PDB
low complexity region 213 239 N/A INTRINSIC
low complexity region 389 410 N/A INTRINSIC
low complexity region 417 440 N/A INTRINSIC
Blast:MIF4G 591 636 7e-9 BLAST
low complexity region 638 660 N/A INTRINSIC
MIF4G 718 946 5.14e-72 SMART
low complexity region 988 1000 N/A INTRINSIC
low complexity region 1045 1059 N/A INTRINSIC
low complexity region 1110 1131 N/A INTRINSIC
low complexity region 1139 1154 N/A INTRINSIC
MA3 1195 1307 3.83e-39 SMART
low complexity region 1394 1405 N/A INTRINSIC
eIF5C 1461 1548 3.78e-33 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000115460
AA Change: V1413I

PolyPhen 2 Score 0.001 (Sensitivity: 0.99; Specificity: 0.15)
SMART Domains Protein: ENSMUSP00000111120
Gene: ENSMUSG00000045983
AA Change: V1413I

DomainStartEndE-ValueType
low complexity region 60 81 N/A INTRINSIC
PDB:1LJ2|D 179 206 1e-10 PDB
low complexity region 260 286 N/A INTRINSIC
low complexity region 436 457 N/A INTRINSIC
low complexity region 464 487 N/A INTRINSIC
Blast:MIF4G 638 683 7e-9 BLAST
low complexity region 685 707 N/A INTRINSIC
MIF4G 765 993 5.14e-72 SMART
low complexity region 1035 1047 N/A INTRINSIC
low complexity region 1092 1106 N/A INTRINSIC
low complexity region 1157 1178 N/A INTRINSIC
low complexity region 1186 1201 N/A INTRINSIC
MA3 1242 1354 3.83e-39 SMART
low complexity region 1441 1452 N/A INTRINSIC
eIF5C 1508 1595 3.78e-33 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000115461
AA Change: V1407I

PolyPhen 2 Score 0.001 (Sensitivity: 0.99; Specificity: 0.15)
SMART Domains Protein: ENSMUSP00000111121
Gene: ENSMUSG00000045983
AA Change: V1407I

DomainStartEndE-ValueType
low complexity region 53 74 N/A INTRINSIC
PDB:1LJ2|D 172 199 1e-10 PDB
low complexity region 253 279 N/A INTRINSIC
low complexity region 429 450 N/A INTRINSIC
low complexity region 457 480 N/A INTRINSIC
Blast:MIF4G 631 676 8e-9 BLAST
low complexity region 678 693 N/A INTRINSIC
MIF4G 759 987 5.14e-72 SMART
low complexity region 1029 1041 N/A INTRINSIC
low complexity region 1086 1100 N/A INTRINSIC
low complexity region 1151 1172 N/A INTRINSIC
low complexity region 1180 1195 N/A INTRINSIC
MA3 1236 1348 3.83e-39 SMART
low complexity region 1435 1446 N/A INTRINSIC
eIF5C 1502 1589 3.78e-33 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000115463
AA Change: V1399I

PolyPhen 2 Score 0.003 (Sensitivity: 0.98; Specificity: 0.44)
SMART Domains Protein: ENSMUSP00000111123
Gene: ENSMUSG00000045983
AA Change: V1399I

DomainStartEndE-ValueType
low complexity region 53 74 N/A INTRINSIC
PDB:1LJ2|D 172 199 1e-10 PDB
low complexity region 253 279 N/A INTRINSIC
low complexity region 429 450 N/A INTRINSIC
low complexity region 457 480 N/A INTRINSIC
Blast:MIF4G 631 676 7e-9 BLAST
low complexity region 678 700 N/A INTRINSIC
MIF4G 758 986 5.14e-72 SMART
low complexity region 1030 1036 N/A INTRINSIC
low complexity region 1078 1092 N/A INTRINSIC
low complexity region 1143 1164 N/A INTRINSIC
low complexity region 1172 1187 N/A INTRINSIC
MA3 1228 1340 3.83e-39 SMART
low complexity region 1427 1438 N/A INTRINSIC
eIF5C 1494 1581 3.78e-33 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000118919
SMART Domains Protein: ENSMUSP00000113719
Gene: ENSMUSG00000050821

DomainStartEndE-ValueType
Pfam:FAM131 1 271 4e-119 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000128594
SMART Domains Protein: ENSMUSP00000144594
Gene: ENSMUSG00000045983

DomainStartEndE-ValueType
PDB:1LJ2|D 8 35 5e-11 PDB
low complexity region 89 115 N/A INTRINSIC
low complexity region 265 286 N/A INTRINSIC
low complexity region 293 316 N/A INTRINSIC
Blast:MIF4G 467 512 4e-9 BLAST
low complexity region 514 536 N/A INTRINSIC
MIF4G 594 795 1.1e-52 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000142344
SMART Domains Protein: ENSMUSP00000116029
Gene: ENSMUSG00000045983

DomainStartEndE-ValueType
low complexity region 53 74 N/A INTRINSIC
PDB:1LJ2|D 172 199 5e-11 PDB
low complexity region 253 279 N/A INTRINSIC
low complexity region 429 450 N/A INTRINSIC
low complexity region 457 480 N/A INTRINSIC
Blast:MIF4G 631 672 6e-8 BLAST
low complexity region 678 693 N/A INTRINSIC
MIF4G 759 958 5.49e-49 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000143939
AA Change: V1116I

PolyPhen 2 Score 0.001 (Sensitivity: 0.99; Specificity: 0.15)
SMART Domains Protein: ENSMUSP00000144320
Gene: ENSMUSG00000045983
AA Change: V1116I

DomainStartEndE-ValueType
low complexity region 139 160 N/A INTRINSIC
low complexity region 167 190 N/A INTRINSIC
Blast:MIF4G 341 386 6e-9 BLAST
low complexity region 388 410 N/A INTRINSIC
MIF4G 468 696 2.2e-74 SMART
low complexity region 738 750 N/A INTRINSIC
low complexity region 795 809 N/A INTRINSIC
low complexity region 860 881 N/A INTRINSIC
low complexity region 889 904 N/A INTRINSIC
MA3 945 1057 1.7e-41 SMART
low complexity region 1144 1155 N/A INTRINSIC
eIF5C 1211 1298 1.8e-35 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000149543
Predicted Effect probably benign
Transcript: ENSMUST00000150333
SMART Domains Protein: ENSMUSP00000144107
Gene: ENSMUSG00000045983

DomainStartEndE-ValueType
PDB:1LJ2|D 113 140 5e-11 PDB
low complexity region 194 220 N/A INTRINSIC
low complexity region 370 391 N/A INTRINSIC
low complexity region 398 421 N/A INTRINSIC
Blast:MIF4G 572 613 9e-8 BLAST
low complexity region 619 641 N/A INTRINSIC
MIF4G 699 900 1.1e-52 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000156226
SMART Domains Protein: ENSMUSP00000119215
Gene: ENSMUSG00000045983

DomainStartEndE-ValueType
low complexity region 53 74 N/A INTRINSIC
Predicted Effect unknown
Transcript: ENSMUST00000231598
AA Change: R55H
Predicted Effect probably benign
Transcript: ENSMUST00000232207
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.6%
  • 20x: 98.8%
Validation Efficiency 100% (94/94)
MGI Phenotype FUNCTION: This gene encodes a member of the eukaryotic translation initiation factors (eIF) that play important roles in translation initiation by mediating recruitment of additional initiation factors and providing a scaffold for ribosome/mRNA-bridging. Along with eIF4A and eIF4E, the encoded protein forms the eIF4F complex that bridges the 5' UTR with the polyadenylated 3' UTR resulting in mRNA circularization, enhanced translation initiation and mRNA stability. Through its association with eIF3, the encoded protein mediates recruitment of the 43S pre-initiation complex to mRNA. Alternative splicing of this gene results in multiple transcript variants. Pseudogenes for this gene have been identified on chromosomes 2 and 13. [provided by RefSeq, Jan 2015]
PHENOTYPE: Mice homozygous for an amino acid substitution (R1207H) are viable and fertile. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 93 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2200002J24Rik T G 7: 30,699,943 I54S probably damaging Het
2310002L09Rik C T 4: 73,942,935 V143M probably benign Het
2610507B11Rik C T 11: 78,273,205 P1124L possibly damaging Het
Abca1 T C 4: 53,042,367 I1902V not run Het
AI314180 T C 4: 58,853,150 N395S probably damaging Het
Apob A C 12: 8,008,124 D2202A probably damaging Het
Arhgap44 T A 11: 65,009,924 S623C probably damaging Het
Arhgef7 T A 8: 11,824,507 W713R possibly damaging Het
Axdnd1 A C 1: 156,338,743 probably null Het
Bcl9l T C 9: 44,508,966 M1223T probably benign Het
Bcl9l C A 9: 44,509,697 H1467N probably damaging Het
Brinp3 A G 1: 146,746,568 N236S probably benign Het
Cckbr T G 7: 105,433,591 L54V probably benign Het
Cd6 G A 19: 10,798,358 Q246* probably null Het
Cep89 G A 7: 35,429,928 R630H probably damaging Het
Ces3a T A 8: 105,055,661 probably null Het
Cgnl1 T A 9: 71,725,635 N145Y probably damaging Het
Col6a5 T C 9: 105,898,735 D1707G probably damaging Het
Cyp2w1 A G 5: 139,356,140 T103A probably damaging Het
Dip2a A T 10: 76,278,583 I1021N probably benign Het
Dnah2 T C 11: 69,495,214 T981A probably benign Het
Dnah8 A G 17: 30,855,944 I4546V probably benign Het
E2f8 A C 7: 48,878,075 F106L probably benign Het
Epha10 G A 4: 124,914,453 V688I probably benign Het
Exoc2 A T 13: 30,911,178 V245D probably benign Het
Eya4 T A 10: 23,226,816 E23D probably benign Het
Fbxw10 T A 11: 62,847,387 W36R possibly damaging Het
Gabbr1 G A 17: 37,047,501 G44S probably benign Het
Gabrg3 T A 7: 57,179,580 Q143L probably benign Het
Gm14412 A C 2: 177,315,867 I78M possibly damaging Het
Gm35339 T C 15: 76,359,107 L989P Het
Gm3854 C T 7: 6,353,887 S233L probably damaging Het
Gm7298 T C 6: 121,760,604 probably null Het
Hpse2 A T 19: 43,388,070 L81Q probably damaging Het
Il18r1 A G 1: 40,471,764 H3R probably benign Het
Kansl1l T C 1: 66,778,014 K396E probably damaging Het
Kbtbd3 T A 9: 4,331,221 S532T probably damaging Het
Lrrtm4 T C 6: 80,022,858 Y418H probably damaging Het
Mfng G A 15: 78,773,065 R70C probably damaging Het
Mx2 T A 16: 97,546,883 I236K probably damaging Het
Mysm1 T C 4: 94,965,132 Q410R probably damaging Het
Nlrp12 T C 7: 3,245,400 N100S probably benign Het
Nlrp4b T A 7: 10,725,074 H773Q probably benign Het
Nlrp5 T A 7: 23,423,918 S735T possibly damaging Het
Nt5c2 G A 19: 46,891,581 R363W probably benign Het
Olfr139 T A 11: 74,044,788 H162L possibly damaging Het
Olfr361 A G 2: 37,084,921 F276L possibly damaging Het
Otud7b A T 3: 96,155,211 Y589F probably benign Het
P2rx1 T A 11: 73,009,253 C165* probably null Het
Pax8 T C 2: 24,429,597 D354G possibly damaging Het
Pdcd11 G A 19: 47,106,432 V552I probably benign Het
Pde6c G T 19: 38,159,753 C485F possibly damaging Het
Pex5 T C 6: 124,399,341 Y434C probably benign Het
Ppargc1a T C 5: 51,462,509 probably null Het
Prss2 A T 6: 41,524,952 D224V possibly damaging Het
Psd2 A G 18: 36,002,979 N440S probably benign Het
Psmb3 T A 11: 97,712,439 D159E probably benign Het
Ptgr2 T G 12: 84,307,801 L252R probably damaging Het
Ptpro A T 6: 137,416,820 N829Y probably damaging Het
Rhobtb2 C A 14: 69,796,831 R315L probably benign Het
Rimbp2 A T 5: 128,789,695 V520D possibly damaging Het
Schip1 A T 3: 68,494,578 Y24F probably benign Het
Sdha A T 13: 74,331,436 V432E probably damaging Het
Sez6 T C 11: 77,977,600 L929P probably damaging Het
Shcbp1l A G 1: 153,447,825 I466V probably benign Het
Skor1 T C 9: 63,144,885 S601G probably damaging Het
Slc6a7 A C 18: 61,005,779 L219R probably damaging Het
Smok2a T C 17: 13,225,626 M30T possibly damaging Het
Sp8 A G 12: 118,849,409 D333G probably damaging Het
Spp1 G A 5: 104,440,334 D201N probably damaging Het
Sstr3 A T 15: 78,540,388 L53Q probably damaging Het
Tacc2 T A 7: 130,623,113 N509K probably benign Het
Tdrd1 T C 19: 56,864,377 V1030A probably damaging Het
Tfrc A G 16: 32,619,167 K346R probably benign Het
Tgm3 G A 2: 130,012,410 probably null Het
Tomm5 C A 4: 45,106,651 L88F unknown Het
Trak1 T A 9: 121,416,198 C46* probably null Het
Trim8 A T 19: 46,515,614 D535V probably damaging Het
Trpm7 A T 2: 126,824,075 Y870* probably null Het
Tspoap1 T C 11: 87,764,310 L286P probably benign Het
Ttll3 AAGTA AAGTAGAGTA 6: 113,399,159 probably null Het
Ttn T A 2: 76,732,045 I28819F probably damaging Het
Twf2 T C 9: 106,211,880 S89P probably damaging Het
Ulk4 C T 9: 121,263,668 E168K possibly damaging Het
Unc13b T A 4: 43,172,737 N1188K unknown Het
Utp6 C T 11: 79,937,730 V528I probably benign Het
Vmn1r78 T C 7: 12,153,314 F284S probably benign Het
Vmn2r54 T A 7: 12,632,269 Q246L probably damaging Het
Vmn2r87 A G 10: 130,477,544 M451T probably benign Het
Vwf C T 6: 125,686,520 P2808L Het
Wwc1 T C 11: 35,869,109 Q693R probably benign Het
Zfp658 T A 7: 43,574,684 H794Q possibly damaging Het
Zfp882 A G 8: 71,913,141 D8G probably damaging Het
Other mutations in Eif4g1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00584:Eif4g1 APN 16 20686754 intron probably benign
IGL00707:Eif4g1 APN 16 20689014 missense probably damaging 1.00
IGL00950:Eif4g1 APN 16 20683628 missense probably damaging 1.00
IGL01397:Eif4g1 APN 16 20679675 missense probably damaging 0.98
IGL01657:Eif4g1 APN 16 20682216 missense possibly damaging 0.94
IGL01875:Eif4g1 APN 16 20681040 missense probably damaging 0.96
IGL02728:Eif4g1 APN 16 20686752 intron probably benign
IGL03155:Eif4g1 APN 16 20692417 missense probably damaging 1.00
IGL03339:Eif4g1 APN 16 20680984 missense possibly damaging 0.72
R0032:Eif4g1 UTSW 16 20685898 missense probably damaging 1.00
R0032:Eif4g1 UTSW 16 20685898 missense probably damaging 1.00
R0138:Eif4g1 UTSW 16 20675345 missense probably damaging 0.99
R0556:Eif4g1 UTSW 16 20675794 missense probably damaging 0.99
R0576:Eif4g1 UTSW 16 20684068 missense probably damaging 0.98
R1424:Eif4g1 UTSW 16 20678942 missense probably benign 0.03
R1469:Eif4g1 UTSW 16 20680008 missense possibly damaging 0.86
R1469:Eif4g1 UTSW 16 20680008 missense possibly damaging 0.86
R1487:Eif4g1 UTSW 16 20678873 unclassified probably benign
R1659:Eif4g1 UTSW 16 20681061 missense probably damaging 0.99
R1697:Eif4g1 UTSW 16 20679780 missense probably damaging 0.99
R1848:Eif4g1 UTSW 16 20681867 missense probably damaging 1.00
R1855:Eif4g1 UTSW 16 20687161 missense possibly damaging 0.77
R1865:Eif4g1 UTSW 16 20678648 missense probably damaging 0.99
R3001:Eif4g1 UTSW 16 20692384 missense probably damaging 1.00
R3002:Eif4g1 UTSW 16 20692384 missense probably damaging 1.00
R4402:Eif4g1 UTSW 16 20678843 unclassified probably benign
R4477:Eif4g1 UTSW 16 20678843 unclassified probably benign
R4478:Eif4g1 UTSW 16 20678843 unclassified probably benign
R4479:Eif4g1 UTSW 16 20678843 unclassified probably benign
R4480:Eif4g1 UTSW 16 20678843 unclassified probably benign
R4623:Eif4g1 UTSW 16 20681345 unclassified probably benign
R4658:Eif4g1 UTSW 16 20685934 missense possibly damaging 0.78
R4751:Eif4g1 UTSW 16 20686515 missense possibly damaging 0.89
R4859:Eif4g1 UTSW 16 20682173 missense probably benign 0.44
R5267:Eif4g1 UTSW 16 20685533 missense probably damaging 0.99
R5376:Eif4g1 UTSW 16 20683827 missense probably damaging 1.00
R5560:Eif4g1 UTSW 16 20686895 missense probably benign
R5719:Eif4g1 UTSW 16 20689011 missense probably damaging 1.00
R6632:Eif4g1 UTSW 16 20685520 missense probably damaging 0.99
R6849:Eif4g1 UTSW 16 20680745 missense probably benign 0.08
R7134:Eif4g1 UTSW 16 20681502 missense probably damaging 1.00
R7861:Eif4g1 UTSW 16 20679702 missense probably benign
R7944:Eif4g1 UTSW 16 20679702 missense probably benign
X0062:Eif4g1 UTSW 16 20684501 missense probably damaging 1.00
X0065:Eif4g1 UTSW 16 20682726 missense probably damaging 1.00
Z1176:Eif4g1 UTSW 16 20673408 intron probably benign
Z1177:Eif4g1 UTSW 16 20683905 missense probably benign 0.06
Z1177:Eif4g1 UTSW 16 20686366 frame shift probably null
Predicted Primers PCR Primer
(F):5'- CACTGAGGTGGTAGTGAGTTCC -3'
(R):5'- AAAGGCAAGTGTCCTCTGG -3'

Sequencing Primer
(F):5'- TATTTAATCTAGGCATAGAAGGGTGG -3'
(R):5'- GGCCAGGAGCTTCAGATTCTTC -3'
Posted On2019-11-26