Incidental Mutation 'R7793:Slc6a7'
ID 600086
Institutional Source Beutler Lab
Gene Symbol Slc6a7
Ensembl Gene ENSMUSG00000052026
Gene Name solute carrier family 6 (neurotransmitter transporter, L-proline), member 7
Synonyms Prot
MMRRC Submission 045849-MU
Accession Numbers
Essential gene? Probably non essential (E-score: 0.109) question?
Stock # R7793 (G1)
Quality Score 225.009
Status Validated
Chromosome 18
Chromosomal Location 61128452-61147294 bp(-) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) A to C at 61138851 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Leucine to Arginine at position 219 (L219R)
Ref Sequence ENSEMBL: ENSMUSP00000025520 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000025520]
AlphaFold Q6PGE7
Predicted Effect probably damaging
Transcript: ENSMUST00000025520
AA Change: L219R

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000025520
Gene: ENSMUSG00000052026
AA Change: L219R

DomainStartEndE-ValueType
Pfam:SNF 37 561 1.2e-231 PFAM
low complexity region 623 634 N/A INTRINSIC
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.6%
  • 20x: 98.8%
Validation Efficiency 100% (94/94)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene is a member of the gamma-aminobutyric acid (GABA) neurotransmitter gene family and encodes a high-affinity mammalian brain L-proline transporter protein. This transporter protein differs from other sodium-dependent plasma membrane carriers by its pharmacological specificity, kinetic properties, and ionic requirements. [provided by RefSeq, Jul 2008]
Allele List at MGI
Other mutations in this stock
Total: 93 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2200002J24Rik T G 7: 30,399,368 (GRCm39) I54S probably damaging Het
2310002L09Rik C T 4: 73,861,172 (GRCm39) V143M probably benign Het
Abca1 T C 4: 53,042,367 (GRCm39) I1902V not run Het
Apob A C 12: 8,058,124 (GRCm39) D2202A probably damaging Het
Arhgap44 T A 11: 64,900,750 (GRCm39) S623C probably damaging Het
Arhgef7 T A 8: 11,874,507 (GRCm39) W713R possibly damaging Het
Axdnd1 A C 1: 156,166,313 (GRCm39) probably null Het
Bcl9l C A 9: 44,420,994 (GRCm39) H1467N probably damaging Het
Bcl9l T C 9: 44,420,263 (GRCm39) M1223T probably benign Het
Bltp2 C T 11: 78,164,031 (GRCm39) P1124L possibly damaging Het
Brinp3 A G 1: 146,622,306 (GRCm39) N236S probably benign Het
Cckbr T G 7: 105,082,798 (GRCm39) L54V probably benign Het
Cd6 G A 19: 10,775,722 (GRCm39) Q246* probably null Het
Cep89 G A 7: 35,129,353 (GRCm39) R630H probably damaging Het
Ces3a T A 8: 105,782,293 (GRCm39) probably null Het
Cgnl1 T A 9: 71,632,917 (GRCm39) N145Y probably damaging Het
Col6a5 T C 9: 105,775,934 (GRCm39) D1707G probably damaging Het
Cyp2w1 A G 5: 139,341,895 (GRCm39) T103A probably damaging Het
Dip2a A T 10: 76,114,417 (GRCm39) I1021N probably benign Het
Dnah2 T C 11: 69,386,040 (GRCm39) T981A probably benign Het
Dnah8 A G 17: 31,074,918 (GRCm39) I4546V probably benign Het
E2f8 A C 7: 48,527,823 (GRCm39) F106L probably benign Het
Ecpas T C 4: 58,853,150 (GRCm39) N395S probably damaging Het
Eif4g1 G A 16: 20,507,364 (GRCm39) V1413I probably benign Het
Epha10 G A 4: 124,808,246 (GRCm39) V688I probably benign Het
Exoc2 A T 13: 31,095,161 (GRCm39) V245D probably benign Het
Eya4 T A 10: 23,102,714 (GRCm39) E23D probably benign Het
Fbxw10 T A 11: 62,738,213 (GRCm39) W36R possibly damaging Het
Gabbr1 G A 17: 37,358,393 (GRCm39) G44S probably benign Het
Gabrg3 T A 7: 56,829,328 (GRCm39) Q143L probably benign Het
Gm14412 A C 2: 177,007,660 (GRCm39) I78M possibly damaging Het
Gm7298 T C 6: 121,737,563 (GRCm39) probably null Het
Hpse2 A T 19: 43,376,509 (GRCm39) L81Q probably damaging Het
Il18r1 A G 1: 40,510,924 (GRCm39) H3R probably benign Het
Kansl1l T C 1: 66,817,173 (GRCm39) K396E probably damaging Het
Kbtbd3 T A 9: 4,331,221 (GRCm39) S532T probably damaging Het
Lrrtm4 T C 6: 79,999,841 (GRCm39) Y418H probably damaging Het
Mfng G A 15: 78,657,265 (GRCm39) R70C probably damaging Het
Mx2 T A 16: 97,348,083 (GRCm39) I236K probably damaging Het
Mysm1 T C 4: 94,853,369 (GRCm39) Q410R probably damaging Het
Nlrp12 T C 7: 3,294,030 (GRCm39) N100S probably benign Het
Nlrp4b T A 7: 10,459,001 (GRCm39) H773Q probably benign Het
Nlrp5 T A 7: 23,123,343 (GRCm39) S735T possibly damaging Het
Nt5c2 G A 19: 46,880,020 (GRCm39) R363W probably benign Het
Or12k8 A G 2: 36,974,933 (GRCm39) F276L possibly damaging Het
Or3a10 T A 11: 73,935,614 (GRCm39) H162L possibly damaging Het
Otud7b A T 3: 96,062,528 (GRCm39) Y589F probably benign Het
P2rx1 T A 11: 72,900,079 (GRCm39) C165* probably null Het
Pax8 T C 2: 24,319,609 (GRCm39) D354G possibly damaging Het
Pdcd11 G A 19: 47,094,871 (GRCm39) V552I probably benign Het
Pde6c G T 19: 38,148,201 (GRCm39) C485F possibly damaging Het
Pex5 T C 6: 124,376,300 (GRCm39) Y434C probably benign Het
Ppargc1a T C 5: 51,619,851 (GRCm39) probably null Het
Prss2 A T 6: 41,501,886 (GRCm39) D224V possibly damaging Het
Psd2 A G 18: 36,136,032 (GRCm39) N440S probably benign Het
Psmb3 T A 11: 97,603,265 (GRCm39) D159E probably benign Het
Ptgr2 T G 12: 84,354,575 (GRCm39) L252R probably damaging Het
Ptpro A T 6: 137,393,818 (GRCm39) N829Y probably damaging Het
Rhobtb2 C A 14: 70,034,280 (GRCm39) R315L probably benign Het
Rimbp2 A T 5: 128,866,759 (GRCm39) V520D possibly damaging Het
Schip1 A T 3: 68,401,911 (GRCm39) Y24F probably benign Het
Sdha A T 13: 74,479,555 (GRCm39) V432E probably damaging Het
Sez6 T C 11: 77,868,426 (GRCm39) L929P probably damaging Het
Shcbp1l A G 1: 153,323,571 (GRCm39) I466V probably benign Het
Skor1 T C 9: 63,052,167 (GRCm39) S601G probably damaging Het
Smok2a T C 17: 13,444,513 (GRCm39) M30T possibly damaging Het
Sp8 A G 12: 118,813,144 (GRCm39) D333G probably damaging Het
Spp1 G A 5: 104,588,200 (GRCm39) D201N probably damaging Het
Sstr3 A T 15: 78,424,588 (GRCm39) L53Q probably damaging Het
Tacc2 T A 7: 130,224,843 (GRCm39) N509K probably benign Het
Tdrd1 T C 19: 56,852,809 (GRCm39) V1030A probably damaging Het
Tfrc A G 16: 32,437,985 (GRCm39) K346R probably benign Het
Tgm3 G A 2: 129,854,330 (GRCm39) probably null Het
Tomm5 C A 4: 45,106,651 (GRCm39) L88F unknown Het
Trak1 T A 9: 121,245,264 (GRCm39) C46* probably null Het
Trim8 A T 19: 46,504,053 (GRCm39) D535V probably damaging Het
Trpm7 A T 2: 126,665,995 (GRCm39) Y870* probably null Het
Tspoap1 T C 11: 87,655,136 (GRCm39) L286P probably benign Het
Ttll3 AAGTA AAGTAGAGTA 6: 113,376,120 (GRCm39) probably null Het
Ttn T A 2: 76,562,389 (GRCm39) I28819F probably damaging Het
Twf2 T C 9: 106,089,079 (GRCm39) S89P probably damaging Het
Ulk4 C T 9: 121,092,734 (GRCm39) E168K possibly damaging Het
Unc13b T A 4: 43,172,737 (GRCm39) N1188K unknown Het
Utp6 C T 11: 79,828,556 (GRCm39) V528I probably benign Het
Vmn1r78 T C 7: 11,887,241 (GRCm39) F284S probably benign Het
Vmn2r54 T A 7: 12,366,196 (GRCm39) Q246L probably damaging Het
Vmn2r87 A G 10: 130,313,413 (GRCm39) M451T probably benign Het
Vwf C T 6: 125,663,483 (GRCm39) P2808L Het
Wdr97 T C 15: 76,243,307 (GRCm39) L989P Het
Wwc1 T C 11: 35,759,936 (GRCm39) Q693R probably benign Het
Zfp582 C T 7: 6,356,886 (GRCm39) S233L probably damaging Het
Zfp658 T A 7: 43,224,108 (GRCm39) H794Q possibly damaging Het
Zfp882 A G 8: 72,666,985 (GRCm39) D8G probably damaging Het
Other mutations in Slc6a7
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00335:Slc6a7 APN 18 61,134,681 (GRCm39) missense possibly damaging 0.88
IGL00433:Slc6a7 APN 18 61,134,363 (GRCm39) critical splice donor site probably null
IGL01391:Slc6a7 APN 18 61,136,382 (GRCm39) missense probably damaging 1.00
IGL01476:Slc6a7 APN 18 61,138,845 (GRCm39) missense probably damaging 1.00
IGL02705:Slc6a7 APN 18 61,142,500 (GRCm39) missense probably damaging 1.00
R0106:Slc6a7 UTSW 18 61,135,295 (GRCm39) missense probably benign 0.04
R0106:Slc6a7 UTSW 18 61,135,295 (GRCm39) missense probably benign 0.04
R0147:Slc6a7 UTSW 18 61,135,183 (GRCm39) splice site probably benign
R0267:Slc6a7 UTSW 18 61,129,783 (GRCm39) missense probably benign 0.00
R1349:Slc6a7 UTSW 18 61,133,615 (GRCm39) missense probably benign 0.03
R1498:Slc6a7 UTSW 18 61,129,764 (GRCm39) missense probably benign 0.02
R1874:Slc6a7 UTSW 18 61,134,470 (GRCm39) splice site probably benign
R2005:Slc6a7 UTSW 18 61,134,713 (GRCm39) missense possibly damaging 0.68
R3051:Slc6a7 UTSW 18 61,142,589 (GRCm39) missense probably damaging 0.96
R3970:Slc6a7 UTSW 18 61,136,417 (GRCm39) missense possibly damaging 0.94
R4573:Slc6a7 UTSW 18 61,135,253 (GRCm39) missense probably benign 0.20
R4835:Slc6a7 UTSW 18 61,135,277 (GRCm39) missense probably benign 0.04
R4942:Slc6a7 UTSW 18 61,137,589 (GRCm39) missense probably damaging 1.00
R5112:Slc6a7 UTSW 18 61,140,448 (GRCm39) missense probably null 0.04
R5426:Slc6a7 UTSW 18 61,136,308 (GRCm39) splice site probably null
R6168:Slc6a7 UTSW 18 61,134,734 (GRCm39) missense probably benign 0.18
R6312:Slc6a7 UTSW 18 61,135,457 (GRCm39) missense probably benign 0.12
R6489:Slc6a7 UTSW 18 61,140,615 (GRCm39) missense probably damaging 1.00
R7131:Slc6a7 UTSW 18 61,135,274 (GRCm39) missense probably damaging 1.00
R7460:Slc6a7 UTSW 18 61,134,674 (GRCm39) missense probably benign 0.02
R7556:Slc6a7 UTSW 18 61,140,514 (GRCm39) nonsense probably null
R7740:Slc6a7 UTSW 18 61,133,495 (GRCm39) missense possibly damaging 0.90
R8183:Slc6a7 UTSW 18 61,140,448 (GRCm39) missense probably null 0.04
R9040:Slc6a7 UTSW 18 61,134,360 (GRCm39) splice site probably benign
R9192:Slc6a7 UTSW 18 61,133,649 (GRCm39) missense probably damaging 1.00
R9445:Slc6a7 UTSW 18 61,138,815 (GRCm39) missense probably damaging 1.00
R9792:Slc6a7 UTSW 18 61,138,866 (GRCm39) missense probably benign 0.33
R9793:Slc6a7 UTSW 18 61,138,866 (GRCm39) missense probably benign 0.33
R9795:Slc6a7 UTSW 18 61,138,866 (GRCm39) missense probably benign 0.33
Predicted Primers PCR Primer
(F):5'- AGGCCCAGTGTCACTACTAACC -3'
(R):5'- AGCTCTAGCCATGCCTAGAAG -3'

Sequencing Primer
(F):5'- GAGAGCCCTCCCAAGTCCTC -3'
(R):5'- CTCTAGCCATGCCTAGAAGGTTGG -3'
Posted On 2019-11-26