Incidental Mutation 'R7794:Ptpn4'
ID600096
Institutional Source Beutler Lab
Gene Symbol Ptpn4
Ensembl Gene ENSMUSG00000026384
Gene Nameprotein tyrosine phosphatase, non-receptor type 4
SynonymsTEP/mPTPMEG, PTPMEG, TEP, testis-enriched phosphatase, hPTP-MEG, protein tyrosine phosphatase, non-receptor type 4 (megakaryocyte)
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.236) question?
Stock #R7794 (G1)
Quality Score225.009
Status Validated
Chromosome1
Chromosomal Location119652467-119837613 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 119726037 bp
ZygosityHeterozygous
Amino Acid Change Glutamic Acid to Glycine at position 275 (E275G)
Ref Sequence ENSEMBL: ENSMUSP00000127713 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000064091] [ENSMUST00000163179] [ENSMUST00000163435]
Predicted Effect probably damaging
Transcript: ENSMUST00000064091
AA Change: E275G

PolyPhen 2 Score 0.980 (Sensitivity: 0.75; Specificity: 0.96)
SMART Domains Protein: ENSMUSP00000067614
Gene: ENSMUSG00000026384
AA Change: E275G

DomainStartEndE-ValueType
B41 25 222 7.33e-80 SMART
FERM_C 226 316 6.48e-34 SMART
FA 322 368 3.28e-12 SMART
PDZ 526 605 2.47e-14 SMART
PTPc 654 913 1.38e-120 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000163179
Predicted Effect probably damaging
Transcript: ENSMUST00000163435
AA Change: E275G

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000127713
Gene: ENSMUSG00000026384
AA Change: E275G

DomainStartEndE-ValueType
B41 25 222 7.33e-80 SMART
FERM_C 226 316 6.48e-34 SMART
FA 322 368 3.28e-12 SMART
PDB:3NFL|D 499 552 4e-30 PDB
Predicted Effect probably benign
Transcript: ENSMUST00000164269
Meta Mutation Damage Score 0.2407 question?
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 100.0%
  • 10x: 99.8%
  • 20x: 99.3%
Validation Efficiency 100% (60/60)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene is a member of the protein tyrosine phosphatase (PTP) family. PTPs are known to be signaling molecules that regulate a variety of cellular processes including cell growth, differentiation, mitotic cycle, and oncogenic transformation. This protein contains a C-terminal PTP domain and an N-terminal domain homologous to the band 4.1 superfamily of cytoskeletal-associated proteins. This PTP has been shown to interact with glutamate receptor delta 2 and epsilon subunits, and is thought to play a role in signalling downstream of the glutamate receptors through tyrosine dephosphorylation. [provided by RefSeq, Jul 2008]
PHENOTYPE: Mice homozygous for a null allele exhibit impaired coordination, abnormal eye blink conditioning behavior, and reduced long term depression. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 62 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abcb11 A T 2: 69,286,678 M542K possibly damaging Het
Abcc3 T A 11: 94,358,871 I1083F probably benign Het
Acsm5 A G 7: 119,538,129 probably benign Het
Acyp1 G T 12: 85,288,279 A22E probably benign Het
Afdn C A 17: 13,882,433 A1090E probably damaging Het
Ahdc1 T G 4: 133,063,978 D843E possibly damaging Het
Bahcc1 G T 11: 120,272,681 E602* probably null Het
Bora A G 14: 99,072,644 T470A possibly damaging Het
Bzw1 T A 1: 58,400,800 S166T probably benign Het
Car13 A G 3: 14,654,888 H120R probably damaging Het
Cstf3 G A 2: 104,590,581 probably benign Het
Dip2a T C 10: 76,276,625 N1080D probably damaging Het
Dis3 A G 14: 99,098,797 L91P probably benign Het
E2f6 A G 12: 16,820,369 D174G possibly damaging Het
Emsy A T 7: 98,600,724 S785R probably benign Het
Fbxl17 A G 17: 63,356,811 I561T probably damaging Het
Gabra6 A T 11: 42,321,041 probably null Het
Gm47996 C G 1: 151,210,794 P209A possibly damaging Het
Gm8765 C G 13: 50,702,308 P661A probably damaging Het
Hcls1 A G 16: 36,962,064 E365G probably damaging Het
Hoxa6 T A 6: 52,206,568 T166S possibly damaging Het
Hydin A G 8: 110,509,083 Y1900C probably damaging Het
I0C0044D17Rik T C 4: 98,820,345 probably benign Het
Ifitm7 T C 16: 13,983,746 T50A probably benign Het
Igkv10-95 A G 6: 68,680,827 Q109R possibly damaging Het
Il1rap A T 16: 26,722,908 H633L probably benign Het
Ippk C T 13: 49,446,342 P275S probably benign Het
Kmt2e G A 5: 23,464,716 G67D probably damaging Het
Kpna6 T C 4: 129,648,051 T518A probably benign Het
March11 A G 15: 26,409,198 I328V probably benign Het
Mbtps1 A G 8: 119,538,884 I308T probably damaging Het
Mug1 A T 6: 121,856,288 D284V possibly damaging Het
Myo16 A G 8: 10,569,913 K1488R unknown Het
Myom2 G A 8: 15,083,259 G384R probably damaging Het
Naa16 A G 14: 79,377,494 Y189H probably damaging Het
Nav3 G A 10: 109,688,856 A2304V probably benign Het
Olfr1145 T A 2: 87,810,474 V218E probably damaging Het
Olfr126 A T 17: 37,850,787 Q65L probably benign Het
Olfr310 T A 7: 86,269,133 I219L probably damaging Het
Orc5 A T 5: 22,533,784 Y160N possibly damaging Het
Pan2 T C 10: 128,316,527 probably null Het
Pcdhb20 A G 18: 37,504,432 R4G probably benign Het
Poc1b A G 10: 99,129,598 S130G possibly damaging Het
Psme2b A G 11: 48,945,856 V88A probably benign Het
Ptpn13 C T 5: 103,492,224 T183M probably benign Het
Rab21 A T 10: 115,298,857 L119* probably null Het
Rep15 T A 6: 147,033,140 I159N probably damaging Het
Rps6kc1 T C 1: 190,783,628 E967G probably benign Het
Rptn G A 3: 93,395,729 R123K probably benign Het
Scn11a A T 9: 119,765,514 V1271D probably damaging Het
Scn5a A T 9: 119,529,087 I696N probably damaging Het
Slc25a12 T C 2: 71,311,508 E267G probably damaging Het
Slc5a4b A T 10: 76,062,299 M527K probably benign Het
Speg T A 1: 75,388,870 S632T probably benign Het
Stard9 G A 2: 120,704,430 G3723S probably benign Het
Synrg G T 11: 84,019,574 M933I probably benign Het
Tmem178b A T 6: 40,245,617 I89F probably damaging Het
Tyr C T 7: 87,483,820 probably null Het
Usp30 T A 5: 114,112,972 C237* probably null Het
Xpo6 G T 7: 126,160,863 T188K probably damaging Het
Zfp382 G A 7: 30,131,610 S108N possibly damaging Het
Zfp820 A C 17: 21,820,128 V73G probably damaging Het
Other mutations in Ptpn4
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00825:Ptpn4 APN 1 119659925 splice site probably benign
IGL00885:Ptpn4 APN 1 119802363 missense possibly damaging 0.95
IGL00973:Ptpn4 APN 1 119741371 missense probably benign 0.00
IGL01867:Ptpn4 APN 1 119675599 missense probably benign
IGL01870:Ptpn4 APN 1 119675547 critical splice donor site probably null
IGL02101:Ptpn4 APN 1 119687678 missense probably damaging 1.00
IGL02344:Ptpn4 APN 1 119773260 missense probably damaging 1.00
IGL02348:Ptpn4 APN 1 119682722 missense probably damaging 1.00
IGL02693:Ptpn4 APN 1 119715969 missense probably damaging 0.96
IGL03281:Ptpn4 APN 1 119659912 missense probably damaging 1.00
botched UTSW 1 119743390 missense probably damaging 1.00
bungled UTSW 1 119687605 splice site probably null
hash UTSW 1 119765919 nonsense probably null
R0105:Ptpn4 UTSW 1 119687605 splice site probably null
R0105:Ptpn4 UTSW 1 119687605 splice site probably null
R0504:Ptpn4 UTSW 1 119765915 missense probably damaging 1.00
R1148:Ptpn4 UTSW 1 119684540 missense probably damaging 0.99
R1148:Ptpn4 UTSW 1 119675709 splice site probably benign
R1148:Ptpn4 UTSW 1 119684540 missense probably damaging 0.99
R1662:Ptpn4 UTSW 1 119765058 missense probably damaging 0.96
R1694:Ptpn4 UTSW 1 119783510 missense probably damaging 0.99
R1733:Ptpn4 UTSW 1 119716043 intron probably null
R2083:Ptpn4 UTSW 1 119687759 missense possibly damaging 0.63
R2226:Ptpn4 UTSW 1 119682785 missense probably damaging 1.00
R2276:Ptpn4 UTSW 1 119684591 missense probably damaging 1.00
R2277:Ptpn4 UTSW 1 119684591 missense probably damaging 1.00
R3123:Ptpn4 UTSW 1 119765423 splice site probably null
R3425:Ptpn4 UTSW 1 119707830 missense probably benign 0.02
R4568:Ptpn4 UTSW 1 119680059 missense probably damaging 1.00
R4716:Ptpn4 UTSW 1 119721868 missense probably damaging 1.00
R4819:Ptpn4 UTSW 1 119659850 missense probably benign
R4959:Ptpn4 UTSW 1 119765096 nonsense probably null
R5161:Ptpn4 UTSW 1 119707863 nonsense probably null
R5345:Ptpn4 UTSW 1 119765477 missense probably benign
R5471:Ptpn4 UTSW 1 119765919 nonsense probably null
R5826:Ptpn4 UTSW 1 119684516 missense probably benign 0.32
R5933:Ptpn4 UTSW 1 119687723 missense probably damaging 0.97
R6075:Ptpn4 UTSW 1 119765136 missense probably damaging 1.00
R6286:Ptpn4 UTSW 1 119721862 critical splice donor site probably null
R6389:Ptpn4 UTSW 1 119721954 missense probably damaging 0.97
R6392:Ptpn4 UTSW 1 119773123 missense probably benign
R6769:Ptpn4 UTSW 1 119715968 missense probably benign 0.01
R6771:Ptpn4 UTSW 1 119715968 missense probably benign 0.01
R6794:Ptpn4 UTSW 1 119743390 missense probably damaging 1.00
R6933:Ptpn4 UTSW 1 119773148 intron probably benign
R6967:Ptpn4 UTSW 1 119684581 nonsense probably null
R6980:Ptpn4 UTSW 1 119743421 missense possibly damaging 0.86
R7150:Ptpn4 UTSW 1 119691745 critical splice donor site probably null
R7247:Ptpn4 UTSW 1 119690034 makesense probably null
R7283:Ptpn4 UTSW 1 119682531 missense possibly damaging 0.90
R7459:Ptpn4 UTSW 1 119659834 missense probably damaging 0.99
R7732:Ptpn4 UTSW 1 119692802 missense probably benign
R8061:Ptpn4 UTSW 1 119691600 critical splice donor site probably null
RF014:Ptpn4 UTSW 1 119684465 critical splice donor site probably null
Predicted Primers PCR Primer
(F):5'- GATCAGCCTATGTCTGCCTC -3'
(R):5'- TTAGTTTTATAGGAAGCACCATGTG -3'

Sequencing Primer
(F):5'- ATGTCTGCCTCCTCATTGTCAG -3'
(R):5'- ACTTCAAAGCGAGTTGGGGTTAC -3'
Posted On2019-11-26