Incidental Mutation 'R7794:Slc25a12'
ID600100
Institutional Source Beutler Lab
Gene Symbol Slc25a12
Ensembl Gene ENSMUSG00000027010
Gene Namesolute carrier family 25 (mitochondrial carrier, Aralar), member 12
Synonyms
MMRRC Submission
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.224) question?
Stock #R7794 (G1)
Quality Score225.009
Status Validated
Chromosome2
Chromosomal Location71271063-71367749 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 71311508 bp
ZygosityHeterozygous
Amino Acid Change Glutamic Acid to Glycine at position 267 (E267G)
Ref Sequence ENSEMBL: ENSMUSP00000122103 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000151937] [ENSMUST00000184169]
Predicted Effect probably damaging
Transcript: ENSMUST00000151937
AA Change: E267G

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000122103
Gene: ENSMUSG00000027010
AA Change: E267G

DomainStartEndE-ValueType
EFh 56 84 1.83e1 SMART
EFh 90 118 5.8e-1 SMART
EFh 161 189 2.49e0 SMART
Pfam:Mito_carr 324 421 3e-27 PFAM
Pfam:Mito_carr 422 513 2.9e-18 PFAM
Pfam:Mito_carr 515 609 2.1e-27 PFAM
low complexity region 662 677 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000184169
SMART Domains Protein: ENSMUSP00000139371
Gene: ENSMUSG00000027010

DomainStartEndE-ValueType
SCOP:d1irja_ 3 71 5e-5 SMART
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 100.0%
  • 10x: 99.8%
  • 20x: 99.3%
Validation Efficiency 100% (60/60)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a calcium-binding mitochondrial carrier protein. The encoded protein localizes to the mitochondria and is involved in the exchange of aspartate for glutamate across the inner mitochondrial membrane. Polymorphisms in this gene may be associated with autism, and mutations in this gene may also be a cause of global cerebral hypomyelination. Alternatively spliced transcript variants have been observed for this gene. [provided by RefSeq, Apr 2012]
PHENOTYPE: Mice homozygous for a null allele show severe growth defects, generalized tremors, postnatal lethality, impaired motor coordination, and CNS dysmyelination associated with decreased synthesis of myelin lipids and a striking reduction in brain aspartate and N-acetylaspartate levels. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 62 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abcb11 A T 2: 69,286,678 M542K possibly damaging Het
Abcc3 T A 11: 94,358,871 I1083F probably benign Het
Acsm5 A G 7: 119,538,129 probably benign Het
Acyp1 G T 12: 85,288,279 A22E probably benign Het
Afdn C A 17: 13,882,433 A1090E probably damaging Het
Ahdc1 T G 4: 133,063,978 D843E possibly damaging Het
Bahcc1 G T 11: 120,272,681 E602* probably null Het
Bora A G 14: 99,072,644 T470A possibly damaging Het
Bzw1 T A 1: 58,400,800 S166T probably benign Het
Car13 A G 3: 14,654,888 H120R probably damaging Het
Cstf3 G A 2: 104,590,581 probably benign Het
Dip2a T C 10: 76,276,625 N1080D probably damaging Het
Dis3 A G 14: 99,098,797 L91P probably benign Het
E2f6 A G 12: 16,820,369 D174G possibly damaging Het
Emsy A T 7: 98,600,724 S785R probably benign Het
Fbxl17 A G 17: 63,356,811 I561T probably damaging Het
Gabra6 A T 11: 42,321,041 probably null Het
Gm47996 C G 1: 151,210,794 P209A possibly damaging Het
Gm8765 C G 13: 50,702,308 P661A probably damaging Het
Hcls1 A G 16: 36,962,064 E365G probably damaging Het
Hoxa6 T A 6: 52,206,568 T166S possibly damaging Het
Hydin A G 8: 110,509,083 Y1900C probably damaging Het
I0C0044D17Rik T C 4: 98,820,345 probably benign Het
Ifitm7 T C 16: 13,983,746 T50A probably benign Het
Igkv10-95 A G 6: 68,680,827 Q109R possibly damaging Het
Il1rap A T 16: 26,722,908 H633L probably benign Het
Ippk C T 13: 49,446,342 P226S Het
Kmt2e G A 5: 23,464,716 G67D probably damaging Het
Kpna6 T C 4: 129,648,051 T518A probably benign Het
March11 A G 15: 26,409,198 I328V probably benign Het
Mbtps1 A G 8: 119,538,884 I308T probably damaging Het
Mug1 A T 6: 121,856,288 D284V possibly damaging Het
Myo16 A G 8: 10,569,913 K1488R unknown Het
Myom2 G A 8: 15,083,259 G384R probably damaging Het
Naa16 A G 14: 79,377,494 Y189H probably damaging Het
Nav3 G A 10: 109,688,856 A2304V probably benign Het
Olfr1145 T A 2: 87,810,474 V218E probably damaging Het
Olfr126 A T 17: 37,850,787 Q65L probably benign Het
Olfr310 T A 7: 86,269,133 I219L probably damaging Het
Orc5 A T 5: 22,533,784 Y160N possibly damaging Het
Pan2 T C 10: 128,316,527 probably null Het
Pcdhb20 A G 18: 37,504,432 R4G probably benign Het
Poc1b A G 10: 99,129,598 S130G possibly damaging Het
Psme2b A G 11: 48,945,856 V88A probably benign Het
Ptpn13 C T 5: 103,492,224 T183M probably benign Het
Ptpn4 T C 1: 119,726,037 E275G probably damaging Het
Rab21 A T 10: 115,298,857 L119* probably null Het
Rep15 T A 6: 147,033,140 I159N probably damaging Het
Rps6kc1 T C 1: 190,783,628 E967G probably benign Het
Rptn G A 3: 93,395,729 R123K probably benign Het
Scn11a A T 9: 119,765,514 V1271D probably damaging Het
Scn5a A T 9: 119,529,087 I696N probably damaging Het
Slc5a4b A T 10: 76,062,299 M527K probably benign Het
Speg T A 1: 75,388,870 S632T probably benign Het
Stard9 G A 2: 120,704,430 G3723S probably benign Het
Synrg G T 11: 84,019,574 M933I probably benign Het
Tmem178b A T 6: 40,245,617 I89F probably damaging Het
Tyr C T 7: 87,483,820 probably null Het
Usp30 T A 5: 114,112,972 C237* probably null Het
Xpo6 G T 7: 126,160,863 T188K probably damaging Het
Zfp382 G A 7: 30,131,610 S108N possibly damaging Het
Zfp820 A C 17: 21,820,128 V73G probably damaging Het
Other mutations in Slc25a12
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00886:Slc25a12 APN 2 71344032 missense possibly damaging 0.63
IGL01116:Slc25a12 APN 2 71293352 splice site probably benign
IGL01375:Slc25a12 APN 2 71308050 splice site probably benign
IGL02631:Slc25a12 APN 2 71296742 missense possibly damaging 0.90
IGL02899:Slc25a12 APN 2 71279635 missense probably damaging 1.00
R0031:Slc25a12 UTSW 2 71333614 missense possibly damaging 0.93
R0689:Slc25a12 UTSW 2 71311493 missense possibly damaging 0.95
R1148:Slc25a12 UTSW 2 71312568 splice site probably benign
R1148:Slc25a12 UTSW 2 71312568 splice site probably benign
R1832:Slc25a12 UTSW 2 71333710 missense possibly damaging 0.85
R2044:Slc25a12 UTSW 2 71312548 missense probably benign 0.00
R4537:Slc25a12 UTSW 2 71275106 utr 3 prime probably benign
R4668:Slc25a12 UTSW 2 71315062 missense probably benign 0.22
R4830:Slc25a12 UTSW 2 71296805 missense probably damaging 1.00
R5476:Slc25a12 UTSW 2 71275322 missense probably benign
R5698:Slc25a12 UTSW 2 71282573 missense probably damaging 1.00
R6074:Slc25a12 UTSW 2 71276454 missense probably benign 0.01
R6516:Slc25a12 UTSW 2 71324083 missense probably damaging 0.97
R7270:Slc25a12 UTSW 2 71324025 missense probably benign
R8022:Slc25a12 UTSW 2 71275189 missense unknown
Z1176:Slc25a12 UTSW 2 71296746 missense probably damaging 0.99
Predicted Primers PCR Primer
(F):5'- AGAGACTTGATGTGCCAGGG -3'
(R):5'- GCAGTTATAGGCTGGATCTGAGC -3'

Sequencing Primer
(F):5'- GAAGCCTCCCCTTCTCAGAG -3'
(R):5'- CAGATTTCTGAGTTCAAGGCCAGC -3'
Posted On2019-11-26