Incidental Mutation 'R7794:Kmt2e'
ID600110
Institutional Source Beutler Lab
Gene Symbol Kmt2e
Ensembl Gene ENSMUSG00000029004
Gene Namelysine (K)-specific methyltransferase 2E
SynonymsD230038D11Rik, 9530077A04Rik, 1810033J14Rik, Mll5
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R7794 (G1)
Quality Score225.009
Status Validated
Chromosome5
Chromosomal Location23434441-23504235 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) G to A at 23464716 bp
ZygosityHeterozygous
Amino Acid Change Glycine to Aspartic acid at position 67 (G67D)
Ref Sequence ENSEMBL: ENSMUSP00000092569 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000094962] [ENSMUST00000115128] [ENSMUST00000196889]
Predicted Effect probably damaging
Transcript: ENSMUST00000094962
AA Change: G67D

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000092569
Gene: ENSMUSG00000029004
AA Change: G67D

DomainStartEndE-ValueType
low complexity region 23 38 N/A INTRINSIC
low complexity region 48 55 N/A INTRINSIC
low complexity region 70 81 N/A INTRINSIC
low complexity region 100 109 N/A INTRINSIC
PHD 120 164 4.25e-8 SMART
SET 328 453 2.13e-26 SMART
low complexity region 487 503 N/A INTRINSIC
low complexity region 569 582 N/A INTRINSIC
low complexity region 854 867 N/A INTRINSIC
low complexity region 882 908 N/A INTRINSIC
low complexity region 933 945 N/A INTRINSIC
low complexity region 951 960 N/A INTRINSIC
low complexity region 1184 1197 N/A INTRINSIC
low complexity region 1214 1237 N/A INTRINSIC
low complexity region 1294 1312 N/A INTRINSIC
low complexity region 1348 1367 N/A INTRINSIC
internal_repeat_1 1434 1496 6.13e-7 PROSPERO
low complexity region 1506 1518 N/A INTRINSIC
low complexity region 1625 1641 N/A INTRINSIC
low complexity region 1677 1705 N/A INTRINSIC
low complexity region 1720 1731 N/A INTRINSIC
internal_repeat_1 1783 1842 6.13e-7 PROSPERO
Predicted Effect probably damaging
Transcript: ENSMUST00000115128
AA Change: G67D

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000110781
Gene: ENSMUSG00000029004
AA Change: G67D

DomainStartEndE-ValueType
low complexity region 23 38 N/A INTRINSIC
low complexity region 48 55 N/A INTRINSIC
low complexity region 70 81 N/A INTRINSIC
low complexity region 100 109 N/A INTRINSIC
PHD 120 164 4.25e-8 SMART
SET 328 453 2.13e-26 SMART
low complexity region 487 503 N/A INTRINSIC
low complexity region 569 582 N/A INTRINSIC
low complexity region 854 867 N/A INTRINSIC
low complexity region 882 908 N/A INTRINSIC
low complexity region 933 945 N/A INTRINSIC
low complexity region 951 960 N/A INTRINSIC
low complexity region 1184 1197 N/A INTRINSIC
low complexity region 1214 1237 N/A INTRINSIC
low complexity region 1294 1312 N/A INTRINSIC
low complexity region 1348 1367 N/A INTRINSIC
internal_repeat_1 1434 1496 6.13e-7 PROSPERO
low complexity region 1506 1518 N/A INTRINSIC
low complexity region 1625 1641 N/A INTRINSIC
low complexity region 1677 1705 N/A INTRINSIC
low complexity region 1720 1731 N/A INTRINSIC
internal_repeat_1 1783 1842 6.13e-7 PROSPERO
Predicted Effect probably damaging
Transcript: ENSMUST00000196889
AA Change: G67D

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000142568
Gene: ENSMUSG00000029004
AA Change: G67D

DomainStartEndE-ValueType
low complexity region 23 38 N/A INTRINSIC
low complexity region 48 55 N/A INTRINSIC
low complexity region 70 81 N/A INTRINSIC
low complexity region 100 109 N/A INTRINSIC
PHD 120 164 2.7e-10 SMART
Blast:SET 216 327 6e-61 BLAST
Blast:SET 328 377 3e-26 BLAST
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 100.0%
  • 10x: 99.8%
  • 20x: 99.3%
Validation Efficiency 100% (60/60)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene is a member of the myeloid/lymphoid or mixed-lineage leukemia (MLL) family and encodes a protein with an N-terminal PHD zinc finger and a central SET domain. Overexpression of the protein inhibits cell cycle progression. Alternate transcriptional splice variants have been characterized. [provided by RefSeq, Jul 2008]
PHENOTYPE: Mice homozygous for a null allele exhibit neonatal and postnatal lethality, reduced fertility and growth, and abnormal lymphopoiesis. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 62 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abcb11 A T 2: 69,286,678 M542K possibly damaging Het
Abcc3 T A 11: 94,358,871 I1083F probably benign Het
Acsm5 A G 7: 119,538,129 probably benign Het
Acyp1 G T 12: 85,288,279 A22E probably benign Het
Afdn C A 17: 13,882,433 A1090E probably damaging Het
Ahdc1 T G 4: 133,063,978 D843E possibly damaging Het
Bahcc1 G T 11: 120,272,681 E602* probably null Het
Bora A G 14: 99,072,644 T470A possibly damaging Het
Bzw1 T A 1: 58,400,800 S166T probably benign Het
Car13 A G 3: 14,654,888 H120R probably damaging Het
Cstf3 G A 2: 104,590,581 probably benign Het
Dip2a T C 10: 76,276,625 N1080D probably damaging Het
Dis3 A G 14: 99,098,797 L91P probably benign Het
E2f6 A G 12: 16,820,369 D174G possibly damaging Het
Emsy A T 7: 98,600,724 S785R probably benign Het
Fbxl17 A G 17: 63,356,811 I561T probably damaging Het
Gabra6 A T 11: 42,321,041 probably null Het
Gm47996 C G 1: 151,210,794 P209A possibly damaging Het
Gm8765 C G 13: 50,702,308 P661A probably damaging Het
Hcls1 A G 16: 36,962,064 E365G probably damaging Het
Hoxa6 T A 6: 52,206,568 T166S possibly damaging Het
Hydin A G 8: 110,509,083 Y1900C probably damaging Het
I0C0044D17Rik T C 4: 98,820,345 probably benign Het
Ifitm7 T C 16: 13,983,746 T50A probably benign Het
Igkv10-95 A G 6: 68,680,827 Q109R possibly damaging Het
Il1rap A T 16: 26,722,908 H633L probably benign Het
Ippk C T 13: 49,446,342 P226S Het
Kpna6 T C 4: 129,648,051 T518A probably benign Het
March11 A G 15: 26,409,198 I328V probably benign Het
Mbtps1 A G 8: 119,538,884 I308T probably damaging Het
Mug1 A T 6: 121,856,288 D284V possibly damaging Het
Myo16 A G 8: 10,569,913 K1488R unknown Het
Myom2 G A 8: 15,083,259 G384R probably damaging Het
Naa16 A G 14: 79,377,494 Y189H probably damaging Het
Nav3 G A 10: 109,688,856 A2304V probably benign Het
Olfr1145 T A 2: 87,810,474 V218E probably damaging Het
Olfr126 A T 17: 37,850,787 Q65L probably benign Het
Olfr310 T A 7: 86,269,133 I219L probably damaging Het
Orc5 A T 5: 22,533,784 Y160N possibly damaging Het
Pan2 T C 10: 128,316,527 probably null Het
Pcdhb20 A G 18: 37,504,432 R4G probably benign Het
Poc1b A G 10: 99,129,598 S130G possibly damaging Het
Psme2b A G 11: 48,945,856 V88A probably benign Het
Ptpn13 C T 5: 103,492,224 T183M probably benign Het
Ptpn4 T C 1: 119,726,037 E275G probably damaging Het
Rab21 A T 10: 115,298,857 L119* probably null Het
Rep15 T A 6: 147,033,140 I159N probably damaging Het
Rps6kc1 T C 1: 190,783,628 E967G probably benign Het
Rptn G A 3: 93,395,729 R123K probably benign Het
Scn11a A T 9: 119,765,514 V1271D probably damaging Het
Scn5a A T 9: 119,529,087 I696N probably damaging Het
Slc25a12 T C 2: 71,311,508 E267G probably damaging Het
Slc5a4b A T 10: 76,062,299 M527K probably benign Het
Speg T A 1: 75,388,870 S632T probably benign Het
Stard9 G A 2: 120,704,430 G3723S probably benign Het
Synrg G T 11: 84,019,574 M933I probably benign Het
Tmem178b A T 6: 40,245,617 I89F probably damaging Het
Tyr C T 7: 87,483,820 probably null Het
Usp30 T A 5: 114,112,972 C237* probably null Het
Xpo6 G T 7: 126,160,863 T188K probably damaging Het
Zfp382 G A 7: 30,131,610 S108N possibly damaging Het
Zfp820 A C 17: 21,820,128 V73G probably damaging Het
Other mutations in Kmt2e
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00783:Kmt2e APN 5 23492358 missense probably damaging 0.99
IGL01330:Kmt2e APN 5 23497948 missense possibly damaging 0.95
IGL01457:Kmt2e APN 5 23502019 missense possibly damaging 0.62
IGL01691:Kmt2e APN 5 23497091 missense probably benign
IGL02274:Kmt2e APN 5 23500760 missense probably benign 0.00
IGL02934:Kmt2e APN 5 23497884 missense probably damaging 0.97
IGL02964:Kmt2e APN 5 23467100 splice site probably benign
IGL03011:Kmt2e APN 5 23497542 missense probably damaging 1.00
IGL03291:Kmt2e APN 5 23499291 missense probably damaging 1.00
R0035:Kmt2e UTSW 5 23485621 splice site probably benign
R0446:Kmt2e UTSW 5 23497534 splice site probably null
R0498:Kmt2e UTSW 5 23478972 nonsense probably null
R0699:Kmt2e UTSW 5 23473583 missense probably benign 0.01
R0701:Kmt2e UTSW 5 23473583 missense probably benign 0.01
R0761:Kmt2e UTSW 5 23503034 nonsense probably null
R1110:Kmt2e UTSW 5 23502655 missense probably damaging 1.00
R1295:Kmt2e UTSW 5 23502404 missense probably damaging 0.99
R1432:Kmt2e UTSW 5 23450321 missense probably benign 0.39
R1495:Kmt2e UTSW 5 23499327 missense possibly damaging 0.83
R1505:Kmt2e UTSW 5 23500535 missense probably null 0.01
R1623:Kmt2e UTSW 5 23482502 missense probably damaging 1.00
R1675:Kmt2e UTSW 5 23482453 nonsense probably null
R1691:Kmt2e UTSW 5 23464849 missense probably damaging 1.00
R1778:Kmt2e UTSW 5 23492364 missense probably damaging 1.00
R1820:Kmt2e UTSW 5 23473547 missense probably damaging 1.00
R1846:Kmt2e UTSW 5 23499486 intron probably benign
R1912:Kmt2e UTSW 5 23492395 missense probably benign 0.07
R2070:Kmt2e UTSW 5 23501995 missense probably benign
R2195:Kmt2e UTSW 5 23502196 unclassified probably null
R2571:Kmt2e UTSW 5 23501887 missense probably benign 0.08
R3901:Kmt2e UTSW 5 23501642 missense probably benign 0.02
R3902:Kmt2e UTSW 5 23501642 missense probably benign 0.02
R3905:Kmt2e UTSW 5 23501626 missense probably benign 0.01
R3906:Kmt2e UTSW 5 23501626 missense probably benign 0.01
R3909:Kmt2e UTSW 5 23501626 missense probably benign 0.01
R3956:Kmt2e UTSW 5 23496025 missense probably benign 0.00
R4242:Kmt2e UTSW 5 23502822 unclassified probably benign
R4299:Kmt2e UTSW 5 23464914 missense probably damaging 1.00
R4448:Kmt2e UTSW 5 23464790 missense possibly damaging 0.80
R4528:Kmt2e UTSW 5 23473558 missense possibly damaging 0.69
R4574:Kmt2e UTSW 5 23492407 missense possibly damaging 0.60
R4719:Kmt2e UTSW 5 23492315 missense probably damaging 1.00
R4754:Kmt2e UTSW 5 23482441 missense possibly damaging 0.88
R4787:Kmt2e UTSW 5 23463083 missense possibly damaging 0.65
R4812:Kmt2e UTSW 5 23502587 missense possibly damaging 0.86
R4853:Kmt2e UTSW 5 23502341 missense probably damaging 1.00
R5138:Kmt2e UTSW 5 23502695 missense probably damaging 0.99
R5306:Kmt2e UTSW 5 23499333 missense probably damaging 0.98
R5659:Kmt2e UTSW 5 23497807 missense probably damaging 0.99
R5907:Kmt2e UTSW 5 23464706 missense probably damaging 1.00
R5920:Kmt2e UTSW 5 23499442 missense possibly damaging 0.50
R6280:Kmt2e UTSW 5 23499516 missense possibly damaging 0.48
R6353:Kmt2e UTSW 5 23493245 missense probably damaging 1.00
R6375:Kmt2e UTSW 5 23499519 missense probably benign
R6553:Kmt2e UTSW 5 23463026 missense probably damaging 0.99
R6572:Kmt2e UTSW 5 23497581 missense possibly damaging 0.66
R6678:Kmt2e UTSW 5 23499295 missense possibly damaging 0.54
R6791:Kmt2e UTSW 5 23499476 intron probably benign
R6792:Kmt2e UTSW 5 23499476 intron probably benign
R6794:Kmt2e UTSW 5 23499476 intron probably benign
R6797:Kmt2e UTSW 5 23482507 missense possibly damaging 0.82
R6947:Kmt2e UTSW 5 23497545 missense probably damaging 1.00
R7023:Kmt2e UTSW 5 23500487 missense possibly damaging 0.46
R7036:Kmt2e UTSW 5 23478743 missense probably null 1.00
R7173:Kmt2e UTSW 5 23464857 missense probably damaging 1.00
R7202:Kmt2e UTSW 5 23492294 unclassified probably benign
R7563:Kmt2e UTSW 5 23500273 missense probably damaging 1.00
R7571:Kmt2e UTSW 5 23478587 missense probably damaging 1.00
R7604:Kmt2e UTSW 5 23501765 missense not run
R7722:Kmt2e UTSW 5 23497018 missense probably benign 0.00
R7758:Kmt2e UTSW 5 23496070 missense possibly damaging 0.92
R8137:Kmt2e UTSW 5 23501954 missense probably damaging 1.00
RF026:Kmt2e UTSW 5 23478509 critical splice acceptor site probably benign
RF028:Kmt2e UTSW 5 23478509 critical splice acceptor site probably benign
RF040:Kmt2e UTSW 5 23478509 critical splice acceptor site probably benign
RF042:Kmt2e UTSW 5 23478509 critical splice acceptor site probably benign
Z1177:Kmt2e UTSW 5 23481208 critical splice acceptor site probably null
Predicted Primers PCR Primer
(F):5'- AGGTGACTTTCATCTACTAGACAG -3'
(R):5'- TCCGTCATCATGTGTAAAACCAC -3'

Sequencing Primer
(F):5'- AGTGACATTAACTTATTACCACTGTG -3'
(R):5'- CATATGCACCTGGTTACATCAGTAC -3'
Posted On2019-11-26