Incidental Mutation 'R7794:Myom2'
ID600124
Institutional Source Beutler Lab
Gene Symbol Myom2
Ensembl Gene ENSMUSG00000031461
Gene Namemyomesin 2
Synonyms
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.137) question?
Stock #R7794 (G1)
Quality Score225.009
Status Validated
Chromosome8
Chromosomal Location15057653-15133541 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) G to A at 15083259 bp
ZygosityHeterozygous
Amino Acid Change Glycine to Arginine at position 384 (G384R)
Ref Sequence ENSEMBL: ENSMUSP00000033842 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000033842]
Predicted Effect probably damaging
Transcript: ENSMUST00000033842
AA Change: G384R

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000033842
Gene: ENSMUSG00000031461
AA Change: G384R

DomainStartEndE-ValueType
low complexity region 34 63 N/A INTRINSIC
low complexity region 79 87 N/A INTRINSIC
coiled coil region 97 129 N/A INTRINSIC
IG 160 247 7.7e-5 SMART
IG 284 373 8.01e-3 SMART
FN3 383 466 1.5e-14 SMART
FN3 511 594 1.79e-12 SMART
FN3 612 693 1.95e-13 SMART
FN3 711 794 8.69e-11 SMART
FN3 813 896 1.86e-10 SMART
IG_like 913 999 1.58e2 SMART
Blast:IG_like 1021 1106 1e-44 BLAST
IG_like 1135 1215 2.27e1 SMART
Blast:IG_like 1227 1321 9e-51 BLAST
IGc2 1357 1425 4.96e-8 SMART
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 100.0%
  • 10x: 99.8%
  • 20x: 99.3%
Validation Efficiency 100% (60/60)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The giant protein titin, together with its associated proteins, interconnects the major structure of sarcomeres, the M bands and Z discs. The C-terminal end of the titin string extends into the M line, where it binds tightly to M-band constituents of apparent molecular masses of 190 kD and 165 kD. The predicted MYOM2 protein contains 1,465 amino acids. Like MYOM1, MYOM2 has a unique N-terminal domain followed by 12 repeat domains with strong homology to either fibronectin type III or immunoglobulin C2 domains. Protein sequence comparisons suggested that the MYOM2 protein and bovine M protein are identical. [provided by RefSeq, Jul 2008]
Allele List at MGI
Other mutations in this stock
Total: 62 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abcb11 A T 2: 69,286,678 M542K possibly damaging Het
Abcc3 T A 11: 94,358,871 I1083F probably benign Het
Acsm5 A G 7: 119,538,129 probably benign Het
Acyp1 G T 12: 85,288,279 A22E probably benign Het
Afdn C A 17: 13,882,433 A1090E probably damaging Het
Ahdc1 T G 4: 133,063,978 D843E possibly damaging Het
Bahcc1 G T 11: 120,272,681 E602* probably null Het
Bora A G 14: 99,072,644 T470A possibly damaging Het
Bzw1 T A 1: 58,400,800 S166T probably benign Het
Car13 A G 3: 14,654,888 H120R probably damaging Het
Cstf3 G A 2: 104,590,581 probably benign Het
Dip2a T C 10: 76,276,625 N1080D probably damaging Het
Dis3 A G 14: 99,098,797 L91P probably benign Het
E2f6 A G 12: 16,820,369 D174G possibly damaging Het
Emsy A T 7: 98,600,724 S785R probably benign Het
Fbxl17 A G 17: 63,356,811 I561T probably damaging Het
Gabra6 A T 11: 42,321,041 probably null Het
Gm47996 C G 1: 151,210,794 P209A possibly damaging Het
Gm8765 C G 13: 50,702,308 P661A probably damaging Het
Hcls1 A G 16: 36,962,064 E365G probably damaging Het
Hoxa6 T A 6: 52,206,568 T166S possibly damaging Het
Hydin A G 8: 110,509,083 Y1900C probably damaging Het
I0C0044D17Rik T C 4: 98,820,345 probably benign Het
Ifitm7 T C 16: 13,983,746 T50A probably benign Het
Igkv10-95 A G 6: 68,680,827 Q109R possibly damaging Het
Il1rap A T 16: 26,722,908 H633L probably benign Het
Ippk C T 13: 49,446,342 P226S Het
Kmt2e G A 5: 23,464,716 G67D probably damaging Het
Kpna6 T C 4: 129,648,051 T518A probably benign Het
March11 A G 15: 26,409,198 I328V probably benign Het
Mbtps1 A G 8: 119,538,884 I308T probably damaging Het
Mug1 A T 6: 121,856,288 D284V possibly damaging Het
Myo16 A G 8: 10,569,913 K1488R unknown Het
Naa16 A G 14: 79,377,494 Y189H probably damaging Het
Nav3 G A 10: 109,688,856 A2304V probably benign Het
Olfr1145 T A 2: 87,810,474 V218E probably damaging Het
Olfr126 A T 17: 37,850,787 Q65L probably benign Het
Olfr310 T A 7: 86,269,133 I219L probably damaging Het
Orc5 A T 5: 22,533,784 Y160N possibly damaging Het
Pan2 T C 10: 128,316,527 probably null Het
Pcdhb20 A G 18: 37,504,432 R4G probably benign Het
Poc1b A G 10: 99,129,598 S130G possibly damaging Het
Psme2b A G 11: 48,945,856 V88A probably benign Het
Ptpn13 C T 5: 103,492,224 T183M probably benign Het
Ptpn4 T C 1: 119,726,037 E275G probably damaging Het
Rab21 A T 10: 115,298,857 L119* probably null Het
Rep15 T A 6: 147,033,140 I159N probably damaging Het
Rps6kc1 T C 1: 190,783,628 E967G probably benign Het
Rptn G A 3: 93,395,729 R123K probably benign Het
Scn11a A T 9: 119,765,514 V1271D probably damaging Het
Scn5a A T 9: 119,529,087 I696N probably damaging Het
Slc25a12 T C 2: 71,311,508 E267G probably damaging Het
Slc5a4b A T 10: 76,062,299 M527K probably benign Het
Speg T A 1: 75,388,870 S632T probably benign Het
Stard9 G A 2: 120,704,430 G3723S probably benign Het
Synrg G T 11: 84,019,574 M933I probably benign Het
Tmem178b A T 6: 40,245,617 I89F probably damaging Het
Tyr C T 7: 87,483,820 probably null Het
Usp30 T A 5: 114,112,972 C237* probably null Het
Xpo6 G T 7: 126,160,863 T188K probably damaging Het
Zfp382 G A 7: 30,131,610 S108N possibly damaging Het
Zfp820 A C 17: 21,820,128 V73G probably damaging Het
Other mutations in Myom2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00422:Myom2 APN 8 15069490 missense probably damaging 1.00
IGL00426:Myom2 APN 8 15069502 missense probably benign 0.00
IGL00503:Myom2 APN 8 15114289 splice site probably null
IGL01515:Myom2 APN 8 15122655 missense probably benign 0.15
IGL01649:Myom2 APN 8 15113755 missense probably benign 0.24
IGL01658:Myom2 APN 8 15077880 missense probably damaging 1.00
IGL01786:Myom2 APN 8 15106330 missense probably damaging 0.99
IGL01924:Myom2 APN 8 15069685 missense probably benign 0.37
IGL01929:Myom2 APN 8 15117698 missense probably damaging 0.96
IGL02016:Myom2 APN 8 15125195 missense probably benign 0.01
IGL02511:Myom2 APN 8 15065743 missense probably benign
IGL02558:Myom2 APN 8 15114237 missense probably benign 0.31
IGL02944:Myom2 APN 8 15104065 critical splice acceptor site probably null
IGL03052:Myom2 APN 8 15123442 splice site probably benign
IGL03195:Myom2 APN 8 15111844 nonsense probably null
IGL03288:Myom2 APN 8 15122679 missense probably damaging 0.99
IGL03402:Myom2 APN 8 15065731 missense probably benign
R0069:Myom2 UTSW 8 15117624 missense probably benign
R0116:Myom2 UTSW 8 15117633 missense probably damaging 1.00
R0131:Myom2 UTSW 8 15083329 missense probably damaging 0.98
R0373:Myom2 UTSW 8 15098419 missense possibly damaging 0.91
R0463:Myom2 UTSW 8 15104123 missense probably benign 0.09
R0544:Myom2 UTSW 8 15069796 missense probably damaging 1.00
R0629:Myom2 UTSW 8 15069783 missense probably damaging 0.98
R0634:Myom2 UTSW 8 15119216 splice site probably benign
R0645:Myom2 UTSW 8 15117698 missense probably damaging 0.96
R0730:Myom2 UTSW 8 15099326 missense probably benign 0.00
R0744:Myom2 UTSW 8 15132924 nonsense probably null
R0836:Myom2 UTSW 8 15132924 nonsense probably null
R1033:Myom2 UTSW 8 15108934 missense probably benign 0.04
R1103:Myom2 UTSW 8 15110827 missense probably benign 0.22
R1110:Myom2 UTSW 8 15122413 missense probably benign 0.44
R1208:Myom2 UTSW 8 15084631 missense probably damaging 1.00
R1208:Myom2 UTSW 8 15084631 missense probably damaging 1.00
R1353:Myom2 UTSW 8 15106424 missense probably damaging 1.00
R1530:Myom2 UTSW 8 15122384 missense probably damaging 1.00
R1544:Myom2 UTSW 8 15104059 splice site probably benign
R1576:Myom2 UTSW 8 15084556 missense probably damaging 1.00
R1758:Myom2 UTSW 8 15065795 missense probably benign 0.00
R1884:Myom2 UTSW 8 15114278 missense probably benign 0.01
R1908:Myom2 UTSW 8 15081023 missense probably damaging 1.00
R1962:Myom2 UTSW 8 15132599 intron probably null
R1977:Myom2 UTSW 8 15085263 missense possibly damaging 0.47
R2018:Myom2 UTSW 8 15131151 missense probably damaging 1.00
R2049:Myom2 UTSW 8 15106379 missense probably damaging 0.97
R2155:Myom2 UTSW 8 15084555 missense probably damaging 0.98
R2314:Myom2 UTSW 8 15063927 missense probably damaging 0.99
R2350:Myom2 UTSW 8 15108835 missense probably benign 0.09
R2358:Myom2 UTSW 8 15112018 missense possibly damaging 0.68
R2904:Myom2 UTSW 8 15098348 missense probably benign 0.00
R3418:Myom2 UTSW 8 15085294 missense probably benign 0.01
R3606:Myom2 UTSW 8 15069775 missense probably damaging 1.00
R3607:Myom2 UTSW 8 15069775 missense probably damaging 1.00
R3735:Myom2 UTSW 8 15069676 missense probably benign 0.01
R3756:Myom2 UTSW 8 15102650 missense probably benign 0.11
R3902:Myom2 UTSW 8 15104165 missense probably benign
R3951:Myom2 UTSW 8 15084556 missense probably benign 0.35
R4240:Myom2 UTSW 8 15132895 missense probably benign 0.10
R4361:Myom2 UTSW 8 15112018 missense possibly damaging 0.68
R4581:Myom2 UTSW 8 15106459 missense probably benign 0.02
R4736:Myom2 UTSW 8 15081271 missense probably damaging 0.99
R5010:Myom2 UTSW 8 15083310 missense probably damaging 0.98
R5108:Myom2 UTSW 8 15132667 missense probably damaging 0.99
R5370:Myom2 UTSW 8 15099343 missense probably benign 0.10
R5427:Myom2 UTSW 8 15113764 missense probably benign 0.03
R5498:Myom2 UTSW 8 15129142 missense probably benign 0.01
R5504:Myom2 UTSW 8 15128879 missense probably damaging 1.00
R5567:Myom2 UTSW 8 15102546 missense probably benign 0.01
R5743:Myom2 UTSW 8 15080914 missense possibly damaging 0.82
R5745:Myom2 UTSW 8 15122705 missense probably benign 0.01
R5844:Myom2 UTSW 8 15131182 critical splice donor site probably null
R5854:Myom2 UTSW 8 15108478 missense probably benign
R6141:Myom2 UTSW 8 15063903 missense probably damaging 1.00
R6209:Myom2 UTSW 8 15104173 missense possibly damaging 0.76
R6248:Myom2 UTSW 8 15098472 splice site probably null
R6378:Myom2 UTSW 8 15099356 missense probably benign 0.11
R6829:Myom2 UTSW 8 15122643 nonsense probably null
R6913:Myom2 UTSW 8 15065710 missense probably benign
R6957:Myom2 UTSW 8 15117741 missense probably null 0.42
R6958:Myom2 UTSW 8 15117741 missense probably null 0.42
R6960:Myom2 UTSW 8 15117741 missense probably null 0.42
R6961:Myom2 UTSW 8 15117741 missense probably null 0.42
R6962:Myom2 UTSW 8 15117741 missense probably null 0.42
R6999:Myom2 UTSW 8 15084531 missense probably benign 0.22
R7148:Myom2 UTSW 8 15084577 missense possibly damaging 0.72
R7210:Myom2 UTSW 8 15104114 missense probably damaging 1.00
R7298:Myom2 UTSW 8 15098411 missense probably damaging 1.00
R7463:Myom2 UTSW 8 15117679 missense probably null 0.94
R7535:Myom2 UTSW 8 15117679 missense probably damaging 1.00
R7573:Myom2 UTSW 8 15122450 missense probably damaging 1.00
R7590:Myom2 UTSW 8 15117679 missense probably damaging 1.00
R7690:Myom2 UTSW 8 15111717 critical splice acceptor site probably null
R7822:Myom2 UTSW 8 15108454 missense probably benign
R7948:Myom2 UTSW 8 15085306 missense probably benign 0.00
R8094:Myom2 UTSW 8 15069418 missense possibly damaging 0.94
R8268:Myom2 UTSW 8 15129157 missense probably damaging 1.00
R8292:Myom2 UTSW 8 15132888 missense probably benign 0.01
RF001:Myom2 UTSW 8 15081418 missense possibly damaging 0.64
Predicted Primers PCR Primer
(F):5'- TCCTGATATCAGTCTGCTGGG -3'
(R):5'- TGAATGGGTCTGTCAGCCTG -3'

Sequencing Primer
(F):5'- CAGTCTGCTGGGTTAATAAACAC -3'
(R):5'- TGTCAGCCTGCAGTGACATC -3'
Posted On2019-11-26