Incidental Mutation 'R7794:Scn11a'
ID 600128
Institutional Source Beutler Lab
Gene Symbol Scn11a
Ensembl Gene ENSMUSG00000034115
Gene Name sodium channel, voltage-gated, type XI, alpha
Synonyms NaN, NSS2, NaT, SNS2
MMRRC Submission 045850-MU
Accession Numbers
Essential gene? Probably non essential (E-score: 0.091) question?
Stock # R7794 (G1)
Quality Score 225.009
Status Validated
Chromosome 9
Chromosomal Location 119582829-119654522 bp(-) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) A to T at 119594580 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Valine to Aspartic acid at position 1271 (V1271D)
Ref Sequence ENSEMBL: ENSMUSP00000065466 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000070617] [ENSMUST00000215718]
AlphaFold Q9R053
Predicted Effect probably damaging
Transcript: ENSMUST00000070617
AA Change: V1271D

PolyPhen 2 Score 0.991 (Sensitivity: 0.71; Specificity: 0.97)
SMART Domains Protein: ENSMUSP00000065466
Gene: ENSMUSG00000034115
AA Change: V1271D

DomainStartEndE-ValueType
low complexity region 27 43 N/A INTRINSIC
Pfam:Ion_trans 128 409 1.1e-72 PFAM
low complexity region 475 487 N/A INTRINSIC
Pfam:Ion_trans 574 810 4e-57 PFAM
Pfam:Na_trans_assoc 814 1030 4.1e-29 PFAM
Pfam:Ion_trans 1034 1300 5.7e-66 PFAM
Pfam:Ion_trans 1346 1595 3e-58 PFAM
low complexity region 1683 1694 N/A INTRINSIC
low complexity region 1733 1744 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000215718
AA Change: V1271D

PolyPhen 2 Score 0.991 (Sensitivity: 0.71; Specificity: 0.97)
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 100.0%
  • 10x: 99.8%
  • 20x: 99.3%
Validation Efficiency 100% (60/60)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] Voltage-gated sodium channels are transmembrane glycoprotein complexes composed of a large alpha subunit with 24 transmembrane domains and one or more regulatory beta subunits. They are responsible for the generation and propagation of action potentials in neurons and muscle. This gene encodes one member of the sodium channel alpha subunit gene family, and is highly expressed in nociceptive neurons of dorsal root ganglia and trigeminal ganglia. It mediates brain-derived neurotrophic factor-evoked membrane depolarization and is a major effector of peripheral inflammatory pain hypersensitivity. Mutations in this gene have been associated with hereditary sensory and autonomic neuropathy type VII and familial episodic pain syndrome-3. Alternative splicing results in multiple transcript variants. [provided by RefSeq, Mar 2017]
PHENOTYPE: Mice homozygous and heterozygous for one null allele display decreased duration of inflammation induced thermal hyperalgesia and decreased late phase pain responses to inflammatory stimuli. Mice homozygous for a second allele appear normal. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 62 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abcb11 A T 2: 69,117,022 (GRCm39) M542K possibly damaging Het
Abcc3 T A 11: 94,249,697 (GRCm39) I1083F probably benign Het
Acsm5 A G 7: 119,137,352 (GRCm39) probably benign Het
Acyp1 G T 12: 85,335,053 (GRCm39) A22E probably benign Het
Afdn C A 17: 14,102,695 (GRCm39) A1090E probably damaging Het
Ahdc1 T G 4: 132,791,289 (GRCm39) D843E possibly damaging Het
Bahcc1 G T 11: 120,163,507 (GRCm39) E602* probably null Het
Bora A G 14: 99,310,080 (GRCm39) T470A possibly damaging Het
Bzw1 T A 1: 58,439,959 (GRCm39) S166T probably benign Het
Car13 A G 3: 14,719,948 (GRCm39) H120R probably damaging Het
Cstf3 G A 2: 104,420,926 (GRCm39) ⇒1 probably benign Het
Dip2a T C 10: 76,112,459 (GRCm39) N1080D probably damaging Het
Dis3 A G 14: 99,336,233 (GRCm39) L91P probably benign Het
E2f6 A G 12: 16,870,370 (GRCm39) D174G possibly damaging Het
Emsy A T 7: 98,249,931 (GRCm39) S785R probably benign Het
Fbxl17 A G 17: 63,663,806 (GRCm39) I561T probably damaging Het
Gabra6 A T 11: 42,211,868 (GRCm39) probably null Het
Gm47996 C G 1: 151,086,545 (GRCm39) P209A possibly damaging Het
Hcls1 A G 16: 36,782,426 (GRCm39) E365G probably damaging Het
Hoxa6 T A 6: 52,183,548 (GRCm39) T166S possibly damaging Het
Hydin A G 8: 111,235,715 (GRCm39) Y1900C probably damaging Het
I0C0044D17Rik T C 4: 98,708,582 (GRCm39) probably benign Het
Ifitm7 T C 16: 13,801,610 (GRCm39) T50A probably benign Het
Igkv10-95 A G 6: 68,657,811 (GRCm39) Q109R possibly damaging Het
Il1rap A T 16: 26,541,658 (GRCm39) H633L probably benign Het
Ippk C T 13: 49,599,818 (GRCm39) P226S Het
Kmt2e G A 5: 23,669,714 (GRCm39) G67D probably damaging Het
Kpna6 T C 4: 129,541,844 (GRCm39) T518A probably benign Het
Marchf11 A G 15: 26,409,284 (GRCm39) I328V probably benign Het
Mbtps1 A G 8: 120,265,623 (GRCm39) I308T probably damaging Het
Mug1 A T 6: 121,833,247 (GRCm39) D284V possibly damaging Het
Myo16 A G 8: 10,619,913 (GRCm39) K1488R unknown Het
Myom2 G A 8: 15,133,259 (GRCm39) G384R probably damaging Het
Naa16 A G 14: 79,614,934 (GRCm39) Y189H probably damaging Het
Nav3 G A 10: 109,524,717 (GRCm39) A2304V probably benign Het
Or12e10 T A 2: 87,640,818 (GRCm39) V218E probably damaging Het
Or14c46 T A 7: 85,918,341 (GRCm39) I219L probably damaging Het
Or14j5 A T 17: 38,161,678 (GRCm39) Q65L probably benign Het
Orc5 A T 5: 22,738,782 (GRCm39) Y160N possibly damaging Het
Pan2 T C 10: 128,152,396 (GRCm39) probably null Het
Pcdhb20 A G 18: 37,637,485 (GRCm39) R4G probably benign Het
Poc1b A G 10: 98,965,460 (GRCm39) S130G possibly damaging Het
Psme2b A G 11: 48,836,683 (GRCm39) V88A probably benign Het
Ptpn13 C T 5: 103,640,090 (GRCm39) T183M probably benign Het
Ptpn4 T C 1: 119,653,767 (GRCm39) E275G probably damaging Het
Rab21 A T 10: 115,134,762 (GRCm39) L119* probably null Het
Rep15 T A 6: 146,934,638 (GRCm39) I159N probably damaging Het
Rps6kc1 T C 1: 190,515,825 (GRCm39) E967G probably benign Het
Rptn G A 3: 93,303,036 (GRCm39) R123K probably benign Het
Scn5a A T 9: 119,358,153 (GRCm39) I696N probably damaging Het
Slc25a12 T C 2: 71,141,852 (GRCm39) E267G probably damaging Het
Slc5a4b A T 10: 75,898,133 (GRCm39) M527K probably benign Het
Spata31e4 C G 13: 50,856,344 (GRCm39) P661A probably damaging Het
Speg T A 1: 75,365,514 (GRCm39) S632T probably benign Het
Stard9 G A 2: 120,534,911 (GRCm39) G3723S probably benign Het
Synrg G T 11: 83,910,400 (GRCm39) M933I probably benign Het
Tmem178b A T 6: 40,222,551 (GRCm39) I89F probably damaging Het
Tyr C T 7: 87,133,028 (GRCm39) probably null Het
Usp30 T A 5: 114,251,033 (GRCm39) C237* probably null Het
Xpo6 G T 7: 125,760,035 (GRCm39) T188K probably damaging Het
Zfp382 G A 7: 29,831,035 (GRCm39) S108N possibly damaging Het
Zfp820 A C 17: 22,039,109 (GRCm39) V73G probably damaging Het
Other mutations in Scn11a
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00087:Scn11a APN 9 119,599,572 (GRCm39) missense probably benign 0.00
IGL00272:Scn11a APN 9 119,645,669 (GRCm39) missense probably damaging 0.98
IGL00332:Scn11a APN 9 119,598,982 (GRCm39) missense probably damaging 1.00
IGL00533:Scn11a APN 9 119,603,447 (GRCm39) missense probably damaging 1.00
IGL00972:Scn11a APN 9 119,623,004 (GRCm39) missense probably benign 0.44
IGL01338:Scn11a APN 9 119,613,227 (GRCm39) splice site probably benign
IGL01534:Scn11a APN 9 119,609,888 (GRCm39) missense probably benign 0.27
IGL01838:Scn11a APN 9 119,587,649 (GRCm39) missense probably damaging 1.00
IGL01991:Scn11a APN 9 119,648,970 (GRCm39) missense probably damaging 0.97
IGL02057:Scn11a APN 9 119,594,536 (GRCm39) missense probably damaging 1.00
IGL02290:Scn11a APN 9 119,603,508 (GRCm39) missense probably damaging 0.97
IGL02454:Scn11a APN 9 119,587,610 (GRCm39) missense probably benign 0.00
IGL02517:Scn11a APN 9 119,621,464 (GRCm39) missense probably damaging 1.00
IGL02567:Scn11a APN 9 119,633,555 (GRCm39) missense probably damaging 0.99
IGL02587:Scn11a APN 9 119,634,750 (GRCm39) missense probably damaging 1.00
IGL03069:Scn11a APN 9 119,619,029 (GRCm39) missense probably benign 0.16
IGL03171:Scn11a APN 9 119,648,913 (GRCm39) missense probably benign 0.00
Kleinie UTSW 9 119,632,569 (GRCm39) missense probably benign 0.16
H8441:Scn11a UTSW 9 119,636,976 (GRCm39) missense probably damaging 1.00
PIT4449001:Scn11a UTSW 9 119,599,014 (GRCm39) missense probably damaging 1.00
R0304:Scn11a UTSW 9 119,648,928 (GRCm39) missense probably benign 0.00
R0519:Scn11a UTSW 9 119,619,185 (GRCm39) missense probably damaging 1.00
R0658:Scn11a UTSW 9 119,640,226 (GRCm39) missense probably benign 0.41
R0828:Scn11a UTSW 9 119,584,073 (GRCm39) missense probably benign 0.00
R0893:Scn11a UTSW 9 119,632,396 (GRCm39) splice site probably null
R0932:Scn11a UTSW 9 119,636,876 (GRCm39) missense probably damaging 1.00
R1061:Scn11a UTSW 9 119,624,729 (GRCm39) missense probably damaging 0.98
R1161:Scn11a UTSW 9 119,584,123 (GRCm39) nonsense probably null
R1162:Scn11a UTSW 9 119,634,710 (GRCm39) splice site probably benign
R1310:Scn11a UTSW 9 119,584,123 (GRCm39) nonsense probably null
R1589:Scn11a UTSW 9 119,598,873 (GRCm39) missense probably damaging 1.00
R1681:Scn11a UTSW 9 119,633,478 (GRCm39) missense possibly damaging 0.46
R1781:Scn11a UTSW 9 119,584,148 (GRCm39) missense probably damaging 1.00
R1812:Scn11a UTSW 9 119,609,931 (GRCm39) nonsense probably null
R1901:Scn11a UTSW 9 119,608,102 (GRCm39) nonsense probably null
R1978:Scn11a UTSW 9 119,609,861 (GRCm39) nonsense probably null
R1985:Scn11a UTSW 9 119,583,744 (GRCm39) missense probably benign 0.19
R2022:Scn11a UTSW 9 119,640,274 (GRCm39) missense possibly damaging 0.88
R2072:Scn11a UTSW 9 119,640,274 (GRCm39) missense possibly damaging 0.88
R2098:Scn11a UTSW 9 119,621,560 (GRCm39) missense possibly damaging 0.67
R2163:Scn11a UTSW 9 119,584,091 (GRCm39) missense probably damaging 1.00
R2250:Scn11a UTSW 9 119,587,668 (GRCm39) missense probably benign 0.01
R2373:Scn11a UTSW 9 119,642,252 (GRCm39) missense probably benign 0.43
R2508:Scn11a UTSW 9 119,594,595 (GRCm39) missense probably damaging 1.00
R3757:Scn11a UTSW 9 119,632,569 (GRCm39) missense probably benign 0.16
R3767:Scn11a UTSW 9 119,613,115 (GRCm39) missense probably damaging 1.00
R3770:Scn11a UTSW 9 119,613,115 (GRCm39) missense probably damaging 1.00
R4089:Scn11a UTSW 9 119,624,719 (GRCm39) splice site probably null
R4092:Scn11a UTSW 9 119,619,036 (GRCm39) missense probably benign 0.03
R4247:Scn11a UTSW 9 119,636,952 (GRCm39) missense probably damaging 1.00
R4279:Scn11a UTSW 9 119,583,428 (GRCm39) missense probably benign 0.25
R4299:Scn11a UTSW 9 119,594,572 (GRCm39) missense probably damaging 0.97
R4403:Scn11a UTSW 9 119,624,733 (GRCm39) missense probably damaging 1.00
R4468:Scn11a UTSW 9 119,584,053 (GRCm39) missense probably damaging 1.00
R4542:Scn11a UTSW 9 119,584,200 (GRCm39) missense probably damaging 1.00
R4644:Scn11a UTSW 9 119,644,269 (GRCm39) splice site probably null
R4739:Scn11a UTSW 9 119,583,627 (GRCm39) missense probably benign 0.39
R4809:Scn11a UTSW 9 119,648,936 (GRCm39) missense probably benign 0.00
R4954:Scn11a UTSW 9 119,587,725 (GRCm39) missense possibly damaging 0.84
R5012:Scn11a UTSW 9 119,609,944 (GRCm39) missense probably benign 0.31
R5044:Scn11a UTSW 9 119,648,897 (GRCm39) missense probably damaging 0.98
R5222:Scn11a UTSW 9 119,644,268 (GRCm39) splice site probably null
R5224:Scn11a UTSW 9 119,583,858 (GRCm39) missense probably damaging 1.00
R5400:Scn11a UTSW 9 119,598,974 (GRCm39) missense probably damaging 0.97
R5555:Scn11a UTSW 9 119,584,304 (GRCm39) missense probably damaging 1.00
R5711:Scn11a UTSW 9 119,618,990 (GRCm39) missense probably damaging 1.00
R5950:Scn11a UTSW 9 119,640,190 (GRCm39) missense probably damaging 1.00
R5984:Scn11a UTSW 9 119,613,082 (GRCm39) missense probably benign
R6057:Scn11a UTSW 9 119,594,514 (GRCm39) missense probably damaging 1.00
R6104:Scn11a UTSW 9 119,624,744 (GRCm39) missense probably damaging 1.00
R6180:Scn11a UTSW 9 119,583,933 (GRCm39) missense probably benign 0.00
R6892:Scn11a UTSW 9 119,636,035 (GRCm39) missense possibly damaging 0.53
R6908:Scn11a UTSW 9 119,621,492 (GRCm39) missense probably damaging 1.00
R6949:Scn11a UTSW 9 119,594,580 (GRCm39) missense probably benign 0.04
R7112:Scn11a UTSW 9 119,583,875 (GRCm39) missense probably damaging 1.00
R7232:Scn11a UTSW 9 119,588,982 (GRCm39) missense probably damaging 1.00
R7261:Scn11a UTSW 9 119,648,899 (GRCm39) missense probably damaging 0.99
R7265:Scn11a UTSW 9 119,644,331 (GRCm39) missense probably damaging 1.00
R7302:Scn11a UTSW 9 119,636,017 (GRCm39) missense probably benign 0.03
R7391:Scn11a UTSW 9 119,624,783 (GRCm39) missense probably damaging 1.00
R7441:Scn11a UTSW 9 119,587,692 (GRCm39) missense probably benign 0.01
R7479:Scn11a UTSW 9 119,588,941 (GRCm39) missense probably benign 0.38
R7608:Scn11a UTSW 9 119,644,379 (GRCm39) splice site probably null
R7768:Scn11a UTSW 9 119,644,338 (GRCm39) missense probably benign 0.13
R7785:Scn11a UTSW 9 119,645,622 (GRCm39) missense probably benign 0.00
R7818:Scn11a UTSW 9 119,613,177 (GRCm39) missense probably damaging 0.97
R7884:Scn11a UTSW 9 119,633,617 (GRCm39) missense probably benign 0.01
R7988:Scn11a UTSW 9 119,594,503 (GRCm39) missense probably damaging 0.97
R8049:Scn11a UTSW 9 119,584,149 (GRCm39) missense probably damaging 1.00
R8127:Scn11a UTSW 9 119,633,578 (GRCm39) missense probably damaging 1.00
R8274:Scn11a UTSW 9 119,632,548 (GRCm39) missense probably benign
R8344:Scn11a UTSW 9 119,611,036 (GRCm39) missense probably benign 0.00
R8346:Scn11a UTSW 9 119,608,047 (GRCm39) missense probably damaging 1.00
R8511:Scn11a UTSW 9 119,618,981 (GRCm39) missense probably damaging 0.99
R8819:Scn11a UTSW 9 119,645,586 (GRCm39) missense probably benign 0.19
R8820:Scn11a UTSW 9 119,645,586 (GRCm39) missense probably benign 0.19
R8837:Scn11a UTSW 9 119,621,410 (GRCm39) missense probably damaging 1.00
R8913:Scn11a UTSW 9 119,623,094 (GRCm39) missense probably damaging 1.00
R8915:Scn11a UTSW 9 119,603,363 (GRCm39) nonsense probably null
R8975:Scn11a UTSW 9 119,587,565 (GRCm39) missense probably damaging 1.00
R9156:Scn11a UTSW 9 119,588,989 (GRCm39) missense possibly damaging 0.75
R9222:Scn11a UTSW 9 119,611,013 (GRCm39) missense probably damaging 0.98
R9355:Scn11a UTSW 9 119,584,160 (GRCm39) missense probably damaging 1.00
R9486:Scn11a UTSW 9 119,624,774 (GRCm39) missense possibly damaging 0.86
R9712:Scn11a UTSW 9 119,619,076 (GRCm39) nonsense probably null
R9766:Scn11a UTSW 9 119,584,181 (GRCm39) missense probably damaging 1.00
Z1088:Scn11a UTSW 9 119,584,308 (GRCm39) missense probably damaging 1.00
Z1177:Scn11a UTSW 9 119,648,886 (GRCm39) missense probably damaging 1.00
Z1177:Scn11a UTSW 9 119,584,064 (GRCm39) missense possibly damaging 0.94
Predicted Primers PCR Primer
(F):5'- ACAACAGCCTTCTTTCTACATTAGC -3'
(R):5'- GCATCTGGAGCTTAGCAAGG -3'

Sequencing Primer
(F):5'- CATCACATTCCCTGCAAGCATTGG -3'
(R):5'- CCGGCAGGATGCTATGTGTTTAAAC -3'
Posted On 2019-11-26