Incidental Mutation 'R7794:Scn11a'
ID600128
Institutional Source Beutler Lab
Gene Symbol Scn11a
Ensembl Gene ENSMUSG00000034115
Gene Namesodium channel, voltage-gated, type XI, alpha
SynonymsNaN, NSS2, NaT, SNS2
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.091) question?
Stock #R7794 (G1)
Quality Score225.009
Status Validated
Chromosome9
Chromosomal Location119753759-119825456 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to T at 119765514 bp
ZygosityHeterozygous
Amino Acid Change Valine to Aspartic acid at position 1271 (V1271D)
Ref Sequence ENSEMBL: ENSMUSP00000065466 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000070617] [ENSMUST00000215718]
Predicted Effect probably damaging
Transcript: ENSMUST00000070617
AA Change: V1271D

PolyPhen 2 Score 0.991 (Sensitivity: 0.71; Specificity: 0.97)
SMART Domains Protein: ENSMUSP00000065466
Gene: ENSMUSG00000034115
AA Change: V1271D

DomainStartEndE-ValueType
low complexity region 27 43 N/A INTRINSIC
Pfam:Ion_trans 128 409 1.1e-72 PFAM
low complexity region 475 487 N/A INTRINSIC
Pfam:Ion_trans 574 810 4e-57 PFAM
Pfam:Na_trans_assoc 814 1030 4.1e-29 PFAM
Pfam:Ion_trans 1034 1300 5.7e-66 PFAM
Pfam:Ion_trans 1346 1595 3e-58 PFAM
low complexity region 1683 1694 N/A INTRINSIC
low complexity region 1733 1744 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000215718
AA Change: V1271D

PolyPhen 2 Score 0.991 (Sensitivity: 0.71; Specificity: 0.97)
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 100.0%
  • 10x: 99.8%
  • 20x: 99.3%
Validation Efficiency 100% (60/60)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] Voltage-gated sodium channels are transmembrane glycoprotein complexes composed of a large alpha subunit with 24 transmembrane domains and one or more regulatory beta subunits. They are responsible for the generation and propagation of action potentials in neurons and muscle. This gene encodes one member of the sodium channel alpha subunit gene family, and is highly expressed in nociceptive neurons of dorsal root ganglia and trigeminal ganglia. It mediates brain-derived neurotrophic factor-evoked membrane depolarization and is a major effector of peripheral inflammatory pain hypersensitivity. Mutations in this gene have been associated with hereditary sensory and autonomic neuropathy type VII and familial episodic pain syndrome-3. Alternative splicing results in multiple transcript variants. [provided by RefSeq, Mar 2017]
PHENOTYPE: Mice homozygous and heterozygous for one null allele display decreased duration of inflammation induced thermal hyperalgesia and decreased late phase pain responses to inflammatory stimuli. Mice homozygous for a second allele appear normal. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 62 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abcb11 A T 2: 69,286,678 M542K possibly damaging Het
Abcc3 T A 11: 94,358,871 I1083F probably benign Het
Acsm5 A G 7: 119,538,129 probably benign Het
Acyp1 G T 12: 85,288,279 A22E probably benign Het
Afdn C A 17: 13,882,433 A1090E probably damaging Het
Ahdc1 T G 4: 133,063,978 D843E possibly damaging Het
Bahcc1 G T 11: 120,272,681 E602* probably null Het
Bora A G 14: 99,072,644 T470A possibly damaging Het
Bzw1 T A 1: 58,400,800 S166T probably benign Het
Car13 A G 3: 14,654,888 H120R probably damaging Het
Cstf3 G A 2: 104,590,581 probably benign Het
Dip2a T C 10: 76,276,625 N1080D probably damaging Het
Dis3 A G 14: 99,098,797 L91P probably benign Het
E2f6 A G 12: 16,820,369 D174G possibly damaging Het
Emsy A T 7: 98,600,724 S785R probably benign Het
Fbxl17 A G 17: 63,356,811 I561T probably damaging Het
Gabra6 A T 11: 42,321,041 probably null Het
Gm47996 C G 1: 151,210,794 P209A possibly damaging Het
Gm8765 C G 13: 50,702,308 P661A probably damaging Het
Hcls1 A G 16: 36,962,064 E365G probably damaging Het
Hoxa6 T A 6: 52,206,568 T166S possibly damaging Het
Hydin A G 8: 110,509,083 Y1900C probably damaging Het
I0C0044D17Rik T C 4: 98,820,345 probably benign Het
Ifitm7 T C 16: 13,983,746 T50A probably benign Het
Igkv10-95 A G 6: 68,680,827 Q109R possibly damaging Het
Il1rap A T 16: 26,722,908 H633L probably benign Het
Ippk C T 13: 49,446,342 P226S Het
Kmt2e G A 5: 23,464,716 G67D probably damaging Het
Kpna6 T C 4: 129,648,051 T518A probably benign Het
March11 A G 15: 26,409,198 I328V probably benign Het
Mbtps1 A G 8: 119,538,884 I308T probably damaging Het
Mug1 A T 6: 121,856,288 D284V possibly damaging Het
Myo16 A G 8: 10,569,913 K1488R unknown Het
Myom2 G A 8: 15,083,259 G384R probably damaging Het
Naa16 A G 14: 79,377,494 Y189H probably damaging Het
Nav3 G A 10: 109,688,856 A2304V probably benign Het
Olfr1145 T A 2: 87,810,474 V218E probably damaging Het
Olfr126 A T 17: 37,850,787 Q65L probably benign Het
Olfr310 T A 7: 86,269,133 I219L probably damaging Het
Orc5 A T 5: 22,533,784 Y160N possibly damaging Het
Pan2 T C 10: 128,316,527 probably null Het
Pcdhb20 A G 18: 37,504,432 R4G probably benign Het
Poc1b A G 10: 99,129,598 S130G possibly damaging Het
Psme2b A G 11: 48,945,856 V88A probably benign Het
Ptpn13 C T 5: 103,492,224 T183M probably benign Het
Ptpn4 T C 1: 119,726,037 E275G probably damaging Het
Rab21 A T 10: 115,298,857 L119* probably null Het
Rep15 T A 6: 147,033,140 I159N probably damaging Het
Rps6kc1 T C 1: 190,783,628 E967G probably benign Het
Rptn G A 3: 93,395,729 R123K probably benign Het
Scn5a A T 9: 119,529,087 I696N probably damaging Het
Slc25a12 T C 2: 71,311,508 E267G probably damaging Het
Slc5a4b A T 10: 76,062,299 M527K probably benign Het
Speg T A 1: 75,388,870 S632T probably benign Het
Stard9 G A 2: 120,704,430 G3723S probably benign Het
Synrg G T 11: 84,019,574 M933I probably benign Het
Tmem178b A T 6: 40,245,617 I89F probably damaging Het
Tyr C T 7: 87,483,820 probably null Het
Usp30 T A 5: 114,112,972 C237* probably null Het
Xpo6 G T 7: 126,160,863 T188K probably damaging Het
Zfp382 G A 7: 30,131,610 S108N possibly damaging Het
Zfp820 A C 17: 21,820,128 V73G probably damaging Het
Other mutations in Scn11a
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00087:Scn11a APN 9 119770506 missense probably benign 0.00
IGL00272:Scn11a APN 9 119816603 missense probably damaging 0.98
IGL00332:Scn11a APN 9 119769916 missense probably damaging 1.00
IGL00533:Scn11a APN 9 119774381 missense probably damaging 1.00
IGL00972:Scn11a APN 9 119793938 missense probably benign 0.44
IGL01338:Scn11a APN 9 119784161 splice site probably benign
IGL01534:Scn11a APN 9 119780822 missense probably benign 0.27
IGL01838:Scn11a APN 9 119758583 missense probably damaging 1.00
IGL01991:Scn11a APN 9 119819904 missense probably damaging 0.97
IGL02057:Scn11a APN 9 119765470 missense probably damaging 1.00
IGL02290:Scn11a APN 9 119774442 missense probably damaging 0.97
IGL02454:Scn11a APN 9 119758544 missense probably benign 0.00
IGL02517:Scn11a APN 9 119792398 missense probably damaging 1.00
IGL02567:Scn11a APN 9 119804489 missense probably damaging 0.99
IGL02587:Scn11a APN 9 119805684 missense probably damaging 1.00
IGL03069:Scn11a APN 9 119789963 missense probably benign 0.16
IGL03171:Scn11a APN 9 119819847 missense probably benign 0.00
Kleinie UTSW 9 119803503 missense probably benign 0.16
H8441:Scn11a UTSW 9 119807910 missense probably damaging 1.00
PIT4449001:Scn11a UTSW 9 119769948 missense probably damaging 1.00
R0304:Scn11a UTSW 9 119819862 missense probably benign 0.00
R0519:Scn11a UTSW 9 119790119 missense probably damaging 1.00
R0658:Scn11a UTSW 9 119811160 missense probably benign 0.41
R0828:Scn11a UTSW 9 119755007 missense probably benign 0.00
R0893:Scn11a UTSW 9 119803330 splice site probably null
R0932:Scn11a UTSW 9 119807810 missense probably damaging 1.00
R1061:Scn11a UTSW 9 119795663 missense probably damaging 0.98
R1161:Scn11a UTSW 9 119755057 nonsense probably null
R1162:Scn11a UTSW 9 119805644 splice site probably benign
R1310:Scn11a UTSW 9 119755057 nonsense probably null
R1589:Scn11a UTSW 9 119769807 missense probably damaging 1.00
R1681:Scn11a UTSW 9 119804412 missense possibly damaging 0.46
R1781:Scn11a UTSW 9 119755082 missense probably damaging 1.00
R1812:Scn11a UTSW 9 119780865 nonsense probably null
R1901:Scn11a UTSW 9 119779036 nonsense probably null
R1978:Scn11a UTSW 9 119780795 nonsense probably null
R1985:Scn11a UTSW 9 119754678 missense probably benign 0.19
R2022:Scn11a UTSW 9 119811208 missense possibly damaging 0.88
R2072:Scn11a UTSW 9 119811208 missense possibly damaging 0.88
R2098:Scn11a UTSW 9 119792494 missense possibly damaging 0.67
R2163:Scn11a UTSW 9 119755025 missense probably damaging 1.00
R2250:Scn11a UTSW 9 119758602 missense probably benign 0.01
R2373:Scn11a UTSW 9 119813186 missense probably benign 0.43
R2508:Scn11a UTSW 9 119765529 missense probably damaging 1.00
R3757:Scn11a UTSW 9 119803503 missense probably benign 0.16
R3767:Scn11a UTSW 9 119784049 missense probably damaging 1.00
R3770:Scn11a UTSW 9 119784049 missense probably damaging 1.00
R4089:Scn11a UTSW 9 119795653 splice site probably null
R4092:Scn11a UTSW 9 119789970 missense probably benign 0.03
R4247:Scn11a UTSW 9 119807886 missense probably damaging 1.00
R4279:Scn11a UTSW 9 119754362 missense probably benign 0.25
R4299:Scn11a UTSW 9 119765506 missense probably damaging 0.97
R4403:Scn11a UTSW 9 119795667 missense probably damaging 1.00
R4468:Scn11a UTSW 9 119754987 missense probably damaging 1.00
R4542:Scn11a UTSW 9 119755134 missense probably damaging 1.00
R4644:Scn11a UTSW 9 119815203 splice site probably null
R4739:Scn11a UTSW 9 119754561 missense probably benign 0.39
R4809:Scn11a UTSW 9 119819870 missense probably benign 0.00
R4954:Scn11a UTSW 9 119758659 missense possibly damaging 0.84
R5012:Scn11a UTSW 9 119780878 missense probably benign 0.31
R5044:Scn11a UTSW 9 119819831 missense probably damaging 0.98
R5222:Scn11a UTSW 9 119815202 splice site probably null
R5224:Scn11a UTSW 9 119754792 missense probably damaging 1.00
R5400:Scn11a UTSW 9 119769908 missense probably damaging 0.97
R5555:Scn11a UTSW 9 119755238 missense probably damaging 1.00
R5711:Scn11a UTSW 9 119789924 missense probably damaging 1.00
R5950:Scn11a UTSW 9 119811124 missense probably damaging 1.00
R5984:Scn11a UTSW 9 119784016 missense probably benign
R6057:Scn11a UTSW 9 119765448 missense probably damaging 1.00
R6104:Scn11a UTSW 9 119795678 missense probably damaging 1.00
R6180:Scn11a UTSW 9 119754867 missense probably benign 0.00
R6892:Scn11a UTSW 9 119806969 missense possibly damaging 0.53
R6908:Scn11a UTSW 9 119792426 missense probably damaging 1.00
R6949:Scn11a UTSW 9 119765514 missense probably benign 0.04
R7112:Scn11a UTSW 9 119754809 missense probably damaging 1.00
R7232:Scn11a UTSW 9 119759916 missense probably damaging 1.00
R7261:Scn11a UTSW 9 119819833 missense probably damaging 0.99
R7265:Scn11a UTSW 9 119815265 missense probably damaging 1.00
R7302:Scn11a UTSW 9 119806951 missense probably benign 0.03
R7391:Scn11a UTSW 9 119795717 missense probably damaging 1.00
R7441:Scn11a UTSW 9 119758626 missense probably benign 0.01
R7479:Scn11a UTSW 9 119759875 missense probably benign 0.38
R7608:Scn11a UTSW 9 119815313 splice site probably null
R7768:Scn11a UTSW 9 119815272 missense probably benign 0.13
R7785:Scn11a UTSW 9 119816556 missense probably benign 0.00
R7818:Scn11a UTSW 9 119784111 missense probably damaging 0.97
R7884:Scn11a UTSW 9 119804551 missense probably benign 0.01
R7988:Scn11a UTSW 9 119765437 missense probably damaging 0.97
R8049:Scn11a UTSW 9 119755083 missense probably damaging 1.00
R8127:Scn11a UTSW 9 119804512 missense probably damaging 1.00
R8274:Scn11a UTSW 9 119803482 missense probably benign
R8344:Scn11a UTSW 9 119781970 missense probably benign 0.00
R8346:Scn11a UTSW 9 119778981 missense probably damaging 1.00
Z1088:Scn11a UTSW 9 119755242 missense probably damaging 1.00
Z1177:Scn11a UTSW 9 119754998 missense possibly damaging 0.94
Z1177:Scn11a UTSW 9 119819820 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- ACAACAGCCTTCTTTCTACATTAGC -3'
(R):5'- GCATCTGGAGCTTAGCAAGG -3'

Sequencing Primer
(F):5'- CATCACATTCCCTGCAAGCATTGG -3'
(R):5'- CCGGCAGGATGCTATGTGTTTAAAC -3'
Posted On2019-11-26