Incidental Mutation 'R7795:Nvl'
ID 600155
Institutional Source Beutler Lab
Gene Symbol Nvl
Ensembl Gene ENSMUSG00000026516
Gene Name nuclear VCP-like
Synonyms 1200009I24Rik
MMRRC Submission 045851-MU
Accession Numbers
Essential gene? Probably essential (E-score: 0.960) question?
Stock # R7795 (G1)
Quality Score 225.009
Status Not validated
Chromosome 1
Chromosomal Location 180914703-180971769 bp(-) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) G to T at 180924722 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Glutamine to Lysine at position 811 (Q811K)
Ref Sequence ENSEMBL: ENSMUSP00000027797 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000027797]
AlphaFold Q9DBY8
PDB Structure Structure and function of the N-terminal nucleolin binding domain of nuclear valocine containing protein like 2 (NVL2) harboring a nucleolar localization signal [SOLUTION NMR]
Predicted Effect probably benign
Transcript: ENSMUST00000027797
AA Change: Q811K

PolyPhen 2 Score 0.005 (Sensitivity: 0.97; Specificity: 0.74)
SMART Domains Protein: ENSMUSP00000027797
Gene: ENSMUSG00000026516
AA Change: Q811K

DomainStartEndE-ValueType
Pfam:Nucleolin_bd 2 72 1.9e-31 PFAM
low complexity region 90 104 N/A INTRINSIC
low complexity region 187 201 N/A INTRINSIC
low complexity region 216 230 N/A INTRINSIC
AAA 296 435 2.94e-23 SMART
low complexity region 524 540 N/A INTRINSIC
AAA 613 749 2.56e-23 SMART
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.7%
  • 20x: 99.2%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of the AAA (ATPases associated with diverse cellular activities) superfamily. Multiple transcript variants encoding different isoforms have been found for this gene. Two encoded proteins, described as major and minor isoforms, have been localized to distinct regions of the nucleus. The largest encoded protein (major isoform) has been localized to the nucleolus and shown to participate in ribosome biosynthesis (PMID: 15469983, 16782053), while the minor isoform has been localized to the nucleoplasmin. [provided by RefSeq, Aug 2011]
Allele List at MGI
Other mutations in this stock
Total: 47 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Ankle1 T C 8: 71,861,337 (GRCm39) S391P probably damaging Het
Ankmy1 T C 1: 92,811,570 (GRCm39) Q606R probably benign Het
Bmf A G 2: 118,377,358 (GRCm39) L130P probably damaging Het
Ccdc88c G A 12: 100,889,570 (GRCm39) T1491I probably benign Het
Cyp2c69 G A 19: 39,864,663 (GRCm39) R272C probably benign Het
Defa27 A G 8: 21,806,354 (GRCm39) N78S probably benign Het
Depdc5 T A 5: 33,101,447 (GRCm39) D912E probably damaging Het
Dsc3 C T 18: 20,099,288 (GRCm39) D743N probably damaging Het
Epcam T C 17: 87,950,983 (GRCm39) V190A probably benign Het
Exoc2 G A 13: 31,060,756 (GRCm39) R583* probably null Het
Extl1 T A 4: 134,091,990 (GRCm39) I288F probably damaging Het
Fam50b G A 13: 34,931,084 (GRCm39) E187K possibly damaging Het
Fcer2a T A 8: 3,732,910 (GRCm39) Y299F probably benign Het
Frmd4a G A 2: 4,595,506 (GRCm39) G439R probably damaging Het
Gal3st4 T C 5: 138,269,100 (GRCm39) H120R probably benign Het
Grid1 C A 14: 35,043,642 (GRCm39) N332K probably damaging Het
Igkv4-68 A G 6: 69,281,896 (GRCm39) Y92H probably damaging Het
Itga1 T C 13: 115,148,772 (GRCm39) E283G probably damaging Het
Ldlrad1 G A 4: 107,066,688 (GRCm39) A8T probably benign Het
Lrrc24 A G 15: 76,602,248 (GRCm39) L169P probably benign Het
Mcidas G A 13: 113,135,521 (GRCm39) G315S probably damaging Het
Mettl8 T C 2: 70,812,243 (GRCm39) T131A probably benign Het
Miip C T 4: 147,947,375 (GRCm39) G236S probably benign Het
Nbr1 T A 11: 101,460,154 (GRCm39) D383E probably damaging Het
Neto1 A T 18: 86,479,198 (GRCm39) K167N probably benign Het
Nkx6-1 A T 5: 101,811,628 (GRCm39) L158Q unknown Het
Nlrp5 G A 7: 23,118,219 (GRCm39) V648M possibly damaging Het
Or13a21 A G 7: 139,999,027 (GRCm39) F220L possibly damaging Het
Or13p3 C A 4: 118,566,855 (GRCm39) H84N possibly damaging Het
Or1j10 A G 2: 36,267,453 (GRCm39) T222A probably benign Het
Or3a1c T A 11: 74,046,844 (GRCm39) L288Q probably damaging Het
Pccb T C 9: 100,881,316 (GRCm39) Y224C probably damaging Het
Pcdh10 T C 3: 45,334,657 (GRCm39) Y324H probably benign Het
Pecam1 C A 11: 106,586,658 (GRCm39) E286* probably null Het
Prl7d1 A T 13: 27,893,263 (GRCm39) L215Q probably damaging Het
Ranbp2 T A 10: 58,319,729 (GRCm39) Y2514* probably null Het
Rgs11 A G 17: 26,426,552 (GRCm39) H261R possibly damaging Het
Samd15 A G 12: 87,247,506 (GRCm39) T64A probably benign Het
Shc4 T A 2: 125,565,285 (GRCm39) S5C probably damaging Het
Shroom3 G A 5: 93,067,508 (GRCm39) V109M probably damaging Het
Spata13 T C 14: 60,929,291 (GRCm39) I283T possibly damaging Het
Sptbn2 C G 19: 4,799,040 (GRCm39) R2037G probably benign Het
Synj2bp G A 12: 81,548,922 (GRCm39) P106S probably benign Het
Tasor T C 14: 27,203,340 (GRCm39) S289P Het
Thoc1 T C 18: 9,986,300 (GRCm39) V344A probably damaging Het
Vmn1r71 A G 7: 10,482,136 (GRCm39) L184S probably damaging Het
Vps45 A G 3: 95,926,936 (GRCm39) I537T probably benign Het
Other mutations in Nvl
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00848:Nvl APN 1 180,932,690 (GRCm39) missense probably damaging 1.00
IGL00943:Nvl APN 1 180,929,199 (GRCm39) missense possibly damaging 0.72
IGL01956:Nvl APN 1 180,962,509 (GRCm39) missense probably benign 0.00
IGL02657:Nvl APN 1 180,934,541 (GRCm39) missense probably damaging 1.00
Nineveh UTSW 1 180,964,471 (GRCm39) missense probably benign 0.00
nubia UTSW 1 180,939,899 (GRCm39) missense probably benign 0.19
IGL03098:Nvl UTSW 1 180,921,471 (GRCm39) missense probably benign 0.37
P0047:Nvl UTSW 1 180,939,867 (GRCm39) missense probably damaging 1.00
R0003:Nvl UTSW 1 180,941,698 (GRCm39) missense probably damaging 1.00
R0114:Nvl UTSW 1 180,947,956 (GRCm39) missense probably benign 0.19
R0265:Nvl UTSW 1 180,962,395 (GRCm39) missense probably damaging 0.96
R0928:Nvl UTSW 1 180,921,467 (GRCm39) missense probably benign 0.00
R1398:Nvl UTSW 1 180,924,691 (GRCm39) splice site probably benign
R1470:Nvl UTSW 1 180,966,827 (GRCm39) missense probably damaging 1.00
R1470:Nvl UTSW 1 180,966,827 (GRCm39) missense probably damaging 1.00
R1529:Nvl UTSW 1 180,936,724 (GRCm39) critical splice donor site probably null
R1934:Nvl UTSW 1 180,926,693 (GRCm39) missense probably damaging 0.96
R2176:Nvl UTSW 1 180,962,639 (GRCm39) splice site probably benign
R2351:Nvl UTSW 1 180,958,357 (GRCm39) missense probably benign 0.03
R4415:Nvl UTSW 1 180,932,679 (GRCm39) missense probably benign
R4570:Nvl UTSW 1 180,971,647 (GRCm39) missense probably benign 0.03
R4720:Nvl UTSW 1 180,929,152 (GRCm39) missense probably damaging 1.00
R4888:Nvl UTSW 1 180,945,191 (GRCm39) missense probably damaging 1.00
R5026:Nvl UTSW 1 180,932,720 (GRCm39) missense probably damaging 1.00
R5507:Nvl UTSW 1 180,962,601 (GRCm39) missense probably damaging 0.98
R5785:Nvl UTSW 1 180,966,863 (GRCm39) missense probably damaging 1.00
R5983:Nvl UTSW 1 180,964,471 (GRCm39) missense probably benign 0.00
R6143:Nvl UTSW 1 180,962,560 (GRCm39) missense probably benign 0.01
R6532:Nvl UTSW 1 180,971,708 (GRCm39) splice site probably null
R6821:Nvl UTSW 1 180,954,535 (GRCm39) nonsense probably null
R7062:Nvl UTSW 1 180,939,899 (GRCm39) missense probably benign 0.19
R7247:Nvl UTSW 1 180,939,851 (GRCm39) critical splice donor site probably null
R7358:Nvl UTSW 1 180,962,601 (GRCm39) missense probably damaging 0.98
R7665:Nvl UTSW 1 180,962,509 (GRCm39) missense probably benign 0.18
R7931:Nvl UTSW 1 180,936,720 (GRCm39) splice site probably benign
R8185:Nvl UTSW 1 180,971,739 (GRCm39) unclassified probably benign
R8806:Nvl UTSW 1 180,922,619 (GRCm39) missense probably benign 0.01
R8933:Nvl UTSW 1 180,966,638 (GRCm39) missense probably benign 0.00
R8975:Nvl UTSW 1 180,958,001 (GRCm39) missense probably benign
R9249:Nvl UTSW 1 180,962,593 (GRCm39) missense probably damaging 1.00
R9584:Nvl UTSW 1 180,958,431 (GRCm39) missense probably benign
R9586:Nvl UTSW 1 180,932,635 (GRCm39) critical splice donor site probably null
X0067:Nvl UTSW 1 180,966,723 (GRCm39) missense possibly damaging 0.58
Predicted Primers PCR Primer
(F):5'- AGGAAGCACATCCATCTATGAAGG -3'
(R):5'- GTCACACCTTCCTCAAGTCC -3'

Sequencing Primer
(F):5'- TGAGCCTTGCACATGCTAAG -3'
(R):5'- TCCTCAAGTCCCTTTCTTCTAAAG -3'
Posted On 2019-11-26