Incidental Mutation 'R7795:Extl1'
ID600165
Institutional Source Beutler Lab
Gene Symbol Extl1
Ensembl Gene ENSMUSG00000028838
Gene Nameexostoses (multiple)-like 1
SynonymsD430033M16Rik
Accession Numbers
Is this an essential gene? Possibly non essential (E-score: 0.376) question?
Stock #R7795 (G1)
Quality Score225.009
Status Not validated
Chromosome4
Chromosomal Location134356372-134383850 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to A at 134364679 bp
ZygosityHeterozygous
Amino Acid Change Isoleucine to Phenylalanine at position 288 (I288F)
Ref Sequence ENSEMBL: ENSMUSP00000030643 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000030643]
Predicted Effect probably damaging
Transcript: ENSMUST00000030643
AA Change: I288F

PolyPhen 2 Score 0.997 (Sensitivity: 0.41; Specificity: 0.98)
SMART Domains Protein: ENSMUSP00000030643
Gene: ENSMUSG00000028838
AA Change: I288F

DomainStartEndE-ValueType
transmembrane domain 7 29 N/A INTRINSIC
Pfam:Exostosin 87 329 2.1e-38 PFAM
Pfam:Glyco_transf_64 412 652 1.7e-84 PFAM
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.7%
  • 20x: 99.2%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene is a member of the multiple exostoses (EXT) family of glycosyltransferases, which function in the chain polymerization of heparan sulfate and heparin. The encoded protein harbors alpha 1,4- N-acetylglucosaminyltransferase activity, and is involved in chain elongation of heparan sulfate and possibly heparin. [provided by RefSeq, Jul 2008]
Allele List at MGI
Other mutations in this stock
Total: 47 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Ankle1 T C 8: 71,408,693 S391P probably damaging Het
Ankmy1 T C 1: 92,883,848 Q606R probably benign Het
Bmf A G 2: 118,546,877 L130P probably damaging Het
Ccdc88c G A 12: 100,923,311 T1491I probably benign Het
Cyp2c69 G A 19: 39,876,219 R272C probably benign Het
Defa27 A G 8: 21,316,338 N78S probably benign Het
Depdc5 T A 5: 32,944,103 D912E probably damaging Het
Dsc3 C T 18: 19,966,231 D743N probably damaging Het
Epcam T C 17: 87,643,555 V190A probably benign Het
Exoc2 G A 13: 30,876,773 R583* probably null Het
Fam208a T C 14: 27,481,383 S289P Het
Fam50b G A 13: 34,747,101 E187K possibly damaging Het
Fcer2a T A 8: 3,682,910 Y299F probably benign Het
Frmd4a G A 2: 4,590,695 G439R probably damaging Het
Gal3st4 T C 5: 138,270,838 H120R probably benign Het
Grid1 C A 14: 35,321,685 N332K probably damaging Het
Igkv4-68 A G 6: 69,304,912 Y92H probably damaging Het
Itga1 T C 13: 115,012,236 E283G probably damaging Het
Ldlrad1 G A 4: 107,209,491 A8T probably benign Het
Lrrc24 A G 15: 76,718,048 L169P probably benign Het
Mcidas G A 13: 112,998,987 G315S probably damaging Het
Mettl8 T C 2: 70,981,899 T131A probably benign Het
Miip C T 4: 147,862,918 G236S probably benign Het
Nbr1 T A 11: 101,569,328 D383E probably damaging Het
Neto1 A T 18: 86,461,073 K167N probably benign Het
Nkx6-1 A T 5: 101,663,762 L158Q unknown Het
Nlrp5 G A 7: 23,418,794 V648M possibly damaging Het
Nvl G T 1: 181,097,157 Q811K probably benign Het
Olfr1341 C A 4: 118,709,658 H84N possibly damaging Het
Olfr338 A G 2: 36,377,441 T222A probably benign Het
Olfr402 T A 11: 74,156,018 L288Q probably damaging Het
Olfr532 A G 7: 140,419,114 F220L possibly damaging Het
Pccb T C 9: 100,999,263 Y224C probably damaging Het
Pcdh10 T C 3: 45,380,222 Y324H probably benign Het
Pecam1 C A 11: 106,695,832 E286* probably null Het
Prl7d1 A T 13: 27,709,280 L215Q probably damaging Het
Ranbp2 T A 10: 58,483,907 Y2514* probably null Het
Rgs11 A G 17: 26,207,578 H261R possibly damaging Het
Samd15 A G 12: 87,200,732 T64A probably benign Het
Shc4 T A 2: 125,723,365 S5C probably damaging Het
Shroom3 G A 5: 92,919,649 V109M probably damaging Het
Spata13 T C 14: 60,691,842 I283T possibly damaging Het
Sptbn2 C G 19: 4,749,012 R2037G probably benign Het
Synj2bp G A 12: 81,502,148 P106S probably benign Het
Thoc1 T C 18: 9,986,300 V344A probably damaging Het
Vmn1r71 A G 7: 10,748,209 L184S probably damaging Het
Vps45 A G 3: 96,019,624 I537T probably benign Het
Other mutations in Extl1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00088:Extl1 APN 4 134358019 missense probably damaging 1.00
IGL01404:Extl1 APN 4 134359203 missense probably benign 0.06
IGL03040:Extl1 APN 4 134360629 splice site probably benign
R0165:Extl1 UTSW 4 134357703 missense probably damaging 1.00
R0566:Extl1 UTSW 4 134357677 unclassified probably benign
R0575:Extl1 UTSW 4 134357677 unclassified probably benign
R0941:Extl1 UTSW 4 134357677 unclassified probably benign
R0943:Extl1 UTSW 4 134357677 unclassified probably benign
R0988:Extl1 UTSW 4 134357677 unclassified probably benign
R0989:Extl1 UTSW 4 134357677 unclassified probably benign
R0990:Extl1 UTSW 4 134357677 unclassified probably benign
R1022:Extl1 UTSW 4 134357677 unclassified probably benign
R1035:Extl1 UTSW 4 134357677 unclassified probably benign
R1344:Extl1 UTSW 4 134359241 missense probably damaging 0.99
R1495:Extl1 UTSW 4 134357677 unclassified probably benign
R1699:Extl1 UTSW 4 134364583 nonsense probably null
R1750:Extl1 UTSW 4 134362688 missense probably benign 0.00
R1768:Extl1 UTSW 4 134371138 missense probably benign
R1883:Extl1 UTSW 4 134364606 missense probably benign 0.01
R2143:Extl1 UTSW 4 134371044 missense probably benign 0.31
R2144:Extl1 UTSW 4 134371044 missense probably benign 0.31
R2155:Extl1 UTSW 4 134363180 missense possibly damaging 0.71
R4298:Extl1 UTSW 4 134357658 missense probably damaging 1.00
R4605:Extl1 UTSW 4 134359834 missense probably benign 0.00
R4606:Extl1 UTSW 4 134371379 missense probably damaging 0.99
R4606:Extl1 UTSW 4 134371380 missense probably benign 0.00
R4787:Extl1 UTSW 4 134364667 missense probably damaging 1.00
R5210:Extl1 UTSW 4 134360584 missense probably benign 0.02
R5776:Extl1 UTSW 4 134357772 missense possibly damaging 0.82
R6216:Extl1 UTSW 4 134363130 missense probably benign
R6392:Extl1 UTSW 4 134364634 missense probably benign 0.44
R6674:Extl1 UTSW 4 134358127 missense probably damaging 0.97
R7218:Extl1 UTSW 4 134359769 missense probably benign 0.14
R7779:Extl1 UTSW 4 134357703 missense probably damaging 1.00
R7779:Extl1 UTSW 4 134360597 missense probably benign 0.25
R7800:Extl1 UTSW 4 134371618 missense probably benign 0.10
X0020:Extl1 UTSW 4 134358021 unclassified probably null
Predicted Primers PCR Primer
(F):5'- TACATCTATGACTGCCCTAGAGG -3'
(R):5'- GATATTCCCCAGCCTCAGTACC -3'

Sequencing Primer
(F):5'- AATGACTACTAGAAGGGGGCC -3'
(R):5'- AGTACCTCTGCCCTTGCACTG -3'
Posted On2019-11-26