Incidental Mutation 'R7795:Pccb'
ID600178
Institutional Source Beutler Lab
Gene Symbol Pccb
Ensembl Gene ENSMUSG00000032527
Gene Namepropionyl Coenzyme A carboxylase, beta polypeptide
Synonyms
MMRRC Submission
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R7795 (G1)
Quality Score225.009
Status Not validated
Chromosome9
Chromosomal Location100982032-101034898 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 100999263 bp
ZygosityHeterozygous
Amino Acid Change Tyrosine to Cysteine at position 224 (Y224C)
Ref Sequence ENSEMBL: ENSMUSP00000035116 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000035116] [ENSMUST00000142676] [ENSMUST00000149322]
Predicted Effect probably damaging
Transcript: ENSMUST00000035116
AA Change: Y224C

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000035116
Gene: ENSMUSG00000032527
AA Change: Y224C

DomainStartEndE-ValueType
low complexity region 2 15 N/A INTRINSIC
Pfam:Carboxyl_trans 59 539 6.2e-197 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000142676
AA Change: Y184C

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000123421
Gene: ENSMUSG00000032527
AA Change: Y184C

DomainStartEndE-ValueType
low complexity region 2 15 N/A INTRINSIC
Pfam:Carboxyl_trans 52 256 3.2e-79 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000149322
AA Change: Y187C

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000118006
Gene: ENSMUSG00000032527
AA Change: Y187C

DomainStartEndE-ValueType
low complexity region 2 15 N/A INTRINSIC
Pfam:Carboxyl_trans 59 187 2.3e-45 PFAM
Pfam:Carboxyl_trans 183 502 2.7e-127 PFAM
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.7%
  • 20x: 99.2%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene is a subunit of the propionyl-CoA carboxylase (PCC) enzyme, which is involved in the catabolism of propionyl-CoA. PCC is a mitochondrial enzyme that probably acts as a dodecamer of six alpha subunits and six beta subunits. This gene encodes the beta subunit of PCC. Defects in this gene are a cause of propionic acidemia type II (PA-2). Multiple transcript variants encoding different isoforms have been found for this gene.[provided by RefSeq, May 2010]
Allele List at MGI
Other mutations in this stock
Total: 47 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Ankle1 T C 8: 71,408,693 S391P probably damaging Het
Ankmy1 T C 1: 92,883,848 Q606R probably benign Het
Bmf A G 2: 118,546,877 L130P probably damaging Het
Ccdc88c G A 12: 100,923,311 T1491I probably benign Het
Cyp2c69 G A 19: 39,876,219 R272C probably benign Het
Defa27 A G 8: 21,316,338 N78S probably benign Het
Depdc5 T A 5: 32,944,103 D912E probably damaging Het
Dsc3 C T 18: 19,966,231 D743N probably damaging Het
Epcam T C 17: 87,643,555 V190A probably benign Het
Exoc2 G A 13: 30,876,773 R583* probably null Het
Extl1 T A 4: 134,364,679 I288F probably damaging Het
Fam208a T C 14: 27,481,383 S289P Het
Fam50b G A 13: 34,747,101 E187K possibly damaging Het
Fcer2a T A 8: 3,682,910 Y299F probably benign Het
Frmd4a G A 2: 4,590,695 G439R probably damaging Het
Gal3st4 T C 5: 138,270,838 H120R probably benign Het
Grid1 C A 14: 35,321,685 N332K probably damaging Het
Igkv4-68 A G 6: 69,304,912 Y92H probably damaging Het
Itga1 T C 13: 115,012,236 E283G probably damaging Het
Ldlrad1 G A 4: 107,209,491 A8T probably benign Het
Lrrc24 A G 15: 76,718,048 L169P probably benign Het
Mcidas G A 13: 112,998,987 G315S probably damaging Het
Mettl8 T C 2: 70,981,899 T131A probably benign Het
Miip C T 4: 147,862,918 G236S probably benign Het
Nbr1 T A 11: 101,569,328 D383E probably damaging Het
Neto1 A T 18: 86,461,073 K167N probably benign Het
Nkx6-1 A T 5: 101,663,762 L158Q unknown Het
Nlrp5 G A 7: 23,418,794 V648M possibly damaging Het
Nvl G T 1: 181,097,157 Q811K probably benign Het
Olfr1341 C A 4: 118,709,658 H84N possibly damaging Het
Olfr338 A G 2: 36,377,441 T222A probably benign Het
Olfr402 T A 11: 74,156,018 L288Q probably damaging Het
Olfr532 A G 7: 140,419,114 F220L possibly damaging Het
Pcdh10 T C 3: 45,380,222 Y324H probably benign Het
Pecam1 C A 11: 106,695,832 E286* probably null Het
Prl7d1 A T 13: 27,709,280 L215Q probably damaging Het
Ranbp2 T A 10: 58,483,907 Y2514* probably null Het
Rgs11 A G 17: 26,207,578 H261R possibly damaging Het
Samd15 A G 12: 87,200,732 T64A probably benign Het
Shc4 T A 2: 125,723,365 S5C probably damaging Het
Shroom3 G A 5: 92,919,649 V109M probably damaging Het
Spata13 T C 14: 60,691,842 I283T possibly damaging Het
Sptbn2 C G 19: 4,749,012 R2037G probably benign Het
Synj2bp G A 12: 81,502,148 P106S probably benign Het
Thoc1 T C 18: 9,986,300 V344A probably damaging Het
Vmn1r71 A G 7: 10,748,209 L184S probably damaging Het
Vps45 A G 3: 96,019,624 I537T probably benign Het
Other mutations in Pccb
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00939:Pccb APN 9 100985869 missense probably damaging 1.00
IGL02101:Pccb APN 9 100987841 missense possibly damaging 0.53
IGL02149:Pccb APN 9 100985190 missense probably damaging 1.00
IGL02938:Pccb APN 9 100984396 missense probably benign 0.35
PIT4402001:Pccb UTSW 9 100995592 missense probably benign 0.01
R0446:Pccb UTSW 9 100982797 missense probably damaging 1.00
R2128:Pccb UTSW 9 100985831 missense probably damaging 1.00
R2292:Pccb UTSW 9 100994632 missense probably benign
R3056:Pccb UTSW 9 101030197 missense probably damaging 1.00
R4574:Pccb UTSW 9 100985199 missense probably damaging 1.00
R4600:Pccb UTSW 9 101034779 missense probably benign
R5087:Pccb UTSW 9 100985243 intron probably benign
R5219:Pccb UTSW 9 100985209 nonsense probably null
R5586:Pccb UTSW 9 100985803 missense possibly damaging 0.87
R5724:Pccb UTSW 9 100987847 missense probably benign 0.02
R6813:Pccb UTSW 9 101023215 missense probably damaging 1.00
R6982:Pccb UTSW 9 101023296 splice site probably null
R7253:Pccb UTSW 9 101031913 missense probably benign 0.01
R7535:Pccb UTSW 9 100994562 splice site probably null
R7822:Pccb UTSW 9 101027084 missense probably damaging 1.00
R8298:Pccb UTSW 9 100985832 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- GCTGTCAGAGAAGTGGTAGTTT -3'
(R):5'- GCTCTTCTGAGAACAGCGTG -3'

Sequencing Primer
(F):5'- CTGAAGGTCCGGAGTTTAAATCCC -3'
(R):5'- AAACAGTGCTACTCTCTGGTGAC -3'
Posted On2019-11-26