Incidental Mutation 'R7795:Prl7d1'
ID 600186
Institutional Source Beutler Lab
Gene Symbol Prl7d1
Ensembl Gene ENSMUSG00000021348
Gene Name prolactin family 7, subfamily d, member 1
Synonyms Plfr, PRP, PLF-RP
MMRRC Submission
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock # R7795 (G1)
Quality Score 225.009
Status Not validated
Chromosome 13
Chromosomal Location 27706337-27716736 bp(-) (GRCm38)
Type of Mutation missense
DNA Base Change (assembly) A to T at 27709280 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change Leucine to Glutamine at position 215 (L215Q)
Ref Sequence ENSEMBL: ENSMUSP00000021776 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000021776] [ENSMUST00000224026]
AlphaFold P04769
Predicted Effect probably damaging
Transcript: ENSMUST00000021776
AA Change: L215Q

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000021776
Gene: ENSMUSG00000021348
AA Change: L215Q

DomainStartEndE-ValueType
Pfam:Hormone_1 17 240 1.1e-78 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000224026
AA Change: L216Q

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.7%
  • 20x: 99.2%
Validation Efficiency
Allele List at MGI
Other mutations in this stock
Total: 47 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Ankle1 T C 8: 71,408,693 S391P probably damaging Het
Ankmy1 T C 1: 92,883,848 Q606R probably benign Het
Bmf A G 2: 118,546,877 L130P probably damaging Het
Ccdc88c G A 12: 100,923,311 T1491I probably benign Het
Cyp2c69 G A 19: 39,876,219 R272C probably benign Het
Defa27 A G 8: 21,316,338 N78S probably benign Het
Depdc5 T A 5: 32,944,103 D912E probably damaging Het
Dsc3 C T 18: 19,966,231 D743N probably damaging Het
Epcam T C 17: 87,643,555 V190A probably benign Het
Exoc2 G A 13: 30,876,773 R583* probably null Het
Extl1 T A 4: 134,364,679 I288F probably damaging Het
Fam208a T C 14: 27,481,383 S289P Het
Fam50b G A 13: 34,747,101 E187K possibly damaging Het
Fcer2a T A 8: 3,682,910 Y299F probably benign Het
Frmd4a G A 2: 4,590,695 G439R probably damaging Het
Gal3st4 T C 5: 138,270,838 H120R probably benign Het
Grid1 C A 14: 35,321,685 N332K probably damaging Het
Igkv4-68 A G 6: 69,304,912 Y92H probably damaging Het
Itga1 T C 13: 115,012,236 E283G probably damaging Het
Ldlrad1 G A 4: 107,209,491 A8T probably benign Het
Lrrc24 A G 15: 76,718,048 L169P probably benign Het
Mcidas G A 13: 112,998,987 G315S probably damaging Het
Mettl8 T C 2: 70,981,899 T131A probably benign Het
Miip C T 4: 147,862,918 G236S probably benign Het
Nbr1 T A 11: 101,569,328 D383E probably damaging Het
Neto1 A T 18: 86,461,073 K167N probably benign Het
Nkx6-1 A T 5: 101,663,762 L158Q unknown Het
Nlrp5 G A 7: 23,418,794 V648M possibly damaging Het
Nvl G T 1: 181,097,157 Q811K probably benign Het
Olfr1341 C A 4: 118,709,658 H84N possibly damaging Het
Olfr338 A G 2: 36,377,441 T222A probably benign Het
Olfr402 T A 11: 74,156,018 L288Q probably damaging Het
Olfr532 A G 7: 140,419,114 F220L possibly damaging Het
Pccb T C 9: 100,999,263 Y224C probably damaging Het
Pcdh10 T C 3: 45,380,222 Y324H probably benign Het
Pecam1 C A 11: 106,695,832 E286* probably null Het
Ranbp2 T A 10: 58,483,907 Y2514* probably null Het
Rgs11 A G 17: 26,207,578 H261R possibly damaging Het
Samd15 A G 12: 87,200,732 T64A probably benign Het
Shc4 T A 2: 125,723,365 S5C probably damaging Het
Shroom3 G A 5: 92,919,649 V109M probably damaging Het
Spata13 T C 14: 60,691,842 I283T possibly damaging Het
Sptbn2 C G 19: 4,749,012 R2037G probably benign Het
Synj2bp G A 12: 81,502,148 P106S probably benign Het
Thoc1 T C 18: 9,986,300 V344A probably damaging Het
Vmn1r71 A G 7: 10,748,209 L184S probably damaging Het
Vps45 A G 3: 96,019,624 I537T probably benign Het
Other mutations in Prl7d1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01390:Prl7d1 APN 13 27710166 missense possibly damaging 0.91
IGL01735:Prl7d1 APN 13 27714389 missense possibly damaging 0.83
IGL02139:Prl7d1 APN 13 27712083 missense probably damaging 1.00
PIT4305001:Prl7d1 UTSW 13 27714337 missense possibly damaging 0.90
PIT4531001:Prl7d1 UTSW 13 27710178 missense probably damaging 1.00
R0555:Prl7d1 UTSW 13 27712055 missense probably benign 0.13
R0625:Prl7d1 UTSW 13 27710140 missense probably benign 0.10
R0631:Prl7d1 UTSW 13 27710182 missense probably benign 0.32
R0837:Prl7d1 UTSW 13 27714338 missense probably benign 0.06
R1403:Prl7d1 UTSW 13 27709197 missense possibly damaging 0.89
R1403:Prl7d1 UTSW 13 27709197 missense possibly damaging 0.89
R1459:Prl7d1 UTSW 13 27709257 missense possibly damaging 0.81
R1643:Prl7d1 UTSW 13 27712131 missense possibly damaging 0.53
R1691:Prl7d1 UTSW 13 27709382 missense probably damaging 0.97
R2016:Prl7d1 UTSW 13 27710173 missense probably damaging 1.00
R3873:Prl7d1 UTSW 13 27716668 start codon destroyed probably null 0.92
R3874:Prl7d1 UTSW 13 27716668 start codon destroyed probably null 0.92
R5251:Prl7d1 UTSW 13 27709244 missense probably benign 0.33
R5275:Prl7d1 UTSW 13 27709247 missense probably damaging 0.99
R5295:Prl7d1 UTSW 13 27709247 missense probably damaging 0.99
R5398:Prl7d1 UTSW 13 27710074 missense probably damaging 1.00
R6798:Prl7d1 UTSW 13 27709397 critical splice acceptor site probably null
R6818:Prl7d1 UTSW 13 27714471 missense probably benign 0.07
R6825:Prl7d1 UTSW 13 27710142 missense probably benign 0.01
R7478:Prl7d1 UTSW 13 27710185 nonsense probably null
R7995:Prl7d1 UTSW 13 27710071 missense probably benign
R8193:Prl7d1 UTSW 13 27709247 missense
R9313:Prl7d1 UTSW 13 27709199 missense probably benign
R9424:Prl7d1 UTSW 13 27710202 missense probably benign 0.00
R9430:Prl7d1 UTSW 13 27714377 missense possibly damaging 0.80
Predicted Primers PCR Primer
(F):5'- CTGGAATGTGACTTAAGCCACAG -3'
(R):5'- CCTTTAGAAGGCATAGGTCAAAGG -3'

Sequencing Primer
(F):5'- CTTAAGCCACAGAAGAATGCTG -3'
(R):5'- GCATAGGTCAAAGGAATACAAACAC -3'
Posted On 2019-11-26