Incidental Mutation 'R7795:Exoc2'
ID 600187
Institutional Source Beutler Lab
Gene Symbol Exoc2
Ensembl Gene ENSMUSG00000021357
Gene Name exocyst complex component 2
Synonyms 2410030I24Rik, Sec5l1, Sec5
MMRRC Submission
Accession Numbers
Is this an essential gene? Probably essential (E-score: 0.957) question?
Stock # R7795 (G1)
Quality Score 225.009
Status Not validated
Chromosome 13
Chromosomal Location 30813919-30974093 bp(-) (GRCm38)
Type of Mutation nonsense
DNA Base Change (assembly) G to A at 30876773 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change Arginine to Stop codon at position 583 (R583*)
Ref Sequence ENSEMBL: ENSMUSP00000021785 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000021785] [ENSMUST00000102946]
AlphaFold Q9D4H1
PDB Structure RAL BINDING DOMAIN FROM SEC5 [SOLUTION NMR]
Predicted Effect probably null
Transcript: ENSMUST00000021785
AA Change: R583*
SMART Domains Protein: ENSMUSP00000021785
Gene: ENSMUSG00000021357
AA Change: R583*

DomainStartEndE-ValueType
Pfam:TIG 8 92 3.2e-10 PFAM
Pfam:Sec5 198 377 3.6e-59 PFAM
low complexity region 572 585 N/A INTRINSIC
Predicted Effect probably null
Transcript: ENSMUST00000102946
AA Change: R583*
SMART Domains Protein: ENSMUSP00000100010
Gene: ENSMUSG00000021357
AA Change: R583*

DomainStartEndE-ValueType
Pfam:TIG 8 92 2.5e-10 PFAM
Pfam:Sec5 198 377 7.5e-59 PFAM
low complexity region 572 585 N/A INTRINSIC
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.7%
  • 20x: 99.2%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene is a component of the exocyst complex, a multi-protein complex essential for the polarized targeting of exocytic vesicles to specific docking sites on the plasma membrane. Though best characterized in yeast, the component proteins and the functions of the exocyst complex have been demonstrated to be highly conserved in higher eukaryotes. At least eight components of the exocyst complex, including this protein, are found to interact with the actin cytoskeletal remodeling and vesicle transport machinery. This interaction has been shown to mediate filopodia formation in fibroblasts. This protein has been shown to interact with the Ral subfamily of GTPases and thereby mediate exocytosis by tethering vesicles to the plasma membrane. Alternative splicing results in multiple transcript variants. [provided by RefSeq, Jul 2012]
Allele List at MGI
Other mutations in this stock
Total: 47 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Ankle1 T C 8: 71,408,693 S391P probably damaging Het
Ankmy1 T C 1: 92,883,848 Q606R probably benign Het
Bmf A G 2: 118,546,877 L130P probably damaging Het
Ccdc88c G A 12: 100,923,311 T1491I probably benign Het
Cyp2c69 G A 19: 39,876,219 R272C probably benign Het
Defa27 A G 8: 21,316,338 N78S probably benign Het
Depdc5 T A 5: 32,944,103 D912E probably damaging Het
Dsc3 C T 18: 19,966,231 D743N probably damaging Het
Epcam T C 17: 87,643,555 V190A probably benign Het
Extl1 T A 4: 134,364,679 I288F probably damaging Het
Fam208a T C 14: 27,481,383 S289P Het
Fam50b G A 13: 34,747,101 E187K possibly damaging Het
Fcer2a T A 8: 3,682,910 Y299F probably benign Het
Frmd4a G A 2: 4,590,695 G439R probably damaging Het
Gal3st4 T C 5: 138,270,838 H120R probably benign Het
Grid1 C A 14: 35,321,685 N332K probably damaging Het
Igkv4-68 A G 6: 69,304,912 Y92H probably damaging Het
Itga1 T C 13: 115,012,236 E283G probably damaging Het
Ldlrad1 G A 4: 107,209,491 A8T probably benign Het
Lrrc24 A G 15: 76,718,048 L169P probably benign Het
Mcidas G A 13: 112,998,987 G315S probably damaging Het
Mettl8 T C 2: 70,981,899 T131A probably benign Het
Miip C T 4: 147,862,918 G236S probably benign Het
Nbr1 T A 11: 101,569,328 D383E probably damaging Het
Neto1 A T 18: 86,461,073 K167N probably benign Het
Nkx6-1 A T 5: 101,663,762 L158Q unknown Het
Nlrp5 G A 7: 23,418,794 V648M possibly damaging Het
Nvl G T 1: 181,097,157 Q811K probably benign Het
Olfr1341 C A 4: 118,709,658 H84N possibly damaging Het
Olfr338 A G 2: 36,377,441 T222A probably benign Het
Olfr402 T A 11: 74,156,018 L288Q probably damaging Het
Olfr532 A G 7: 140,419,114 F220L possibly damaging Het
Pccb T C 9: 100,999,263 Y224C probably damaging Het
Pcdh10 T C 3: 45,380,222 Y324H probably benign Het
Pecam1 C A 11: 106,695,832 E286* probably null Het
Prl7d1 A T 13: 27,709,280 L215Q probably damaging Het
Ranbp2 T A 10: 58,483,907 Y2514* probably null Het
Rgs11 A G 17: 26,207,578 H261R possibly damaging Het
Samd15 A G 12: 87,200,732 T64A probably benign Het
Shc4 T A 2: 125,723,365 S5C probably damaging Het
Shroom3 G A 5: 92,919,649 V109M probably damaging Het
Spata13 T C 14: 60,691,842 I283T possibly damaging Het
Sptbn2 C G 19: 4,749,012 R2037G probably benign Het
Synj2bp G A 12: 81,502,148 P106S probably benign Het
Thoc1 T C 18: 9,986,300 V344A probably damaging Het
Vmn1r71 A G 7: 10,748,209 L184S probably damaging Het
Vps45 A G 3: 96,019,624 I537T probably benign Het
Other mutations in Exoc2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00095:Exoc2 APN 13 30820626 missense probably benign 0.17
IGL01839:Exoc2 APN 13 30906799 missense probably damaging 1.00
IGL02092:Exoc2 APN 13 30875277 missense probably benign 0.09
IGL02245:Exoc2 APN 13 30906859 missense probably benign 0.10
IGL02267:Exoc2 APN 13 30815321 missense probably benign
IGL02478:Exoc2 APN 13 30927420 missense probably benign
IGL02500:Exoc2 APN 13 30911196 missense probably damaging 1.00
IGL03081:Exoc2 APN 13 30900902 missense probably benign 0.28
IGL03112:Exoc2 APN 13 30906587 splice site probably benign
IGL03409:Exoc2 APN 13 30940737 utr 5 prime probably benign
R0284:Exoc2 UTSW 13 30877625 splice site probably benign
R0452:Exoc2 UTSW 13 30886327 splice site probably benign
R0826:Exoc2 UTSW 13 30856797 critical splice acceptor site probably null
R1251:Exoc2 UTSW 13 30886276 missense probably benign 0.03
R1367:Exoc2 UTSW 13 30882273 nonsense probably null
R1501:Exoc2 UTSW 13 30935502 missense probably benign 0.01
R1593:Exoc2 UTSW 13 30856761 missense possibly damaging 0.64
R1839:Exoc2 UTSW 13 30906497 splice site probably benign
R1872:Exoc2 UTSW 13 30822661 missense probably benign 0.17
R2064:Exoc2 UTSW 13 30935561 missense probably benign 0.00
R2070:Exoc2 UTSW 13 30815370 missense probably benign 0.00
R2227:Exoc2 UTSW 13 30864884 missense probably benign
R2507:Exoc2 UTSW 13 30882365 missense possibly damaging 0.55
R3965:Exoc2 UTSW 13 30877582 missense probably benign 0.00
R4601:Exoc2 UTSW 13 30882268 missense probably benign 0.05
R4914:Exoc2 UTSW 13 30876813 missense probably benign 0.21
R5299:Exoc2 UTSW 13 30871918 splice site probably null
R5410:Exoc2 UTSW 13 30864856 missense probably damaging 0.98
R5461:Exoc2 UTSW 13 30925755 missense possibly damaging 0.66
R5956:Exoc2 UTSW 13 30820623 missense probably benign 0.03
R6056:Exoc2 UTSW 13 30900829 missense probably benign 0.03
R6107:Exoc2 UTSW 13 30876797 missense probably benign
R6548:Exoc2 UTSW 13 30826064 missense possibly damaging 0.86
R6692:Exoc2 UTSW 13 30935507 missense probably benign 0.09
R6969:Exoc2 UTSW 13 30911178 missense probably benign
R7386:Exoc2 UTSW 13 30906663 splice site probably null
R7461:Exoc2 UTSW 13 30882272 missense probably benign 0.32
R7467:Exoc2 UTSW 13 30925733 missense probably damaging 0.98
R7473:Exoc2 UTSW 13 30822630 critical splice donor site probably null
R7613:Exoc2 UTSW 13 30882272 missense probably benign 0.32
R7767:Exoc2 UTSW 13 30876769 missense probably benign 0.01
R7793:Exoc2 UTSW 13 30911178 missense probably benign 0.00
R7993:Exoc2 UTSW 13 30906730 critical splice donor site probably null
R8085:Exoc2 UTSW 13 30940703 missense probably damaging 1.00
R8330:Exoc2 UTSW 13 30877573 missense probably benign
R8716:Exoc2 UTSW 13 30911244 missense probably damaging 1.00
R8735:Exoc2 UTSW 13 30906839 missense probably damaging 1.00
R8922:Exoc2 UTSW 13 30871855 missense probably benign 0.05
R9237:Exoc2 UTSW 13 30864875 missense probably benign
R9243:Exoc2 UTSW 13 30925795 missense probably benign 0.03
R9365:Exoc2 UTSW 13 30856714 missense probably benign 0.00
Predicted Primers PCR Primer
(F):5'- ACTGCTAACGGTGTTCTGATTTC -3'
(R):5'- ATGCTGTCACTCCTGAGCTC -3'

Sequencing Primer
(F):5'- ATCCACATGTTTTTAACCTGGGAC -3'
(R):5'- TCACTCCTGAGCTCCGTGAG -3'
Posted On 2019-11-26