Incidental Mutation 'R7795:Itga1'
ID600190
Institutional Source Beutler Lab
Gene Symbol Itga1
Ensembl Gene ENSMUSG00000042284
Gene Nameintegrin alpha 1
SynonymsCD49A, Vla1, E130012M19Rik
Accession Numbers
Is this an essential gene? Possibly non essential (E-score: 0.446) question?
Stock #R7795 (G1)
Quality Score225.009
Status Not validated
Chromosome13
Chromosomal Location114953096-115101964 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 115012236 bp
ZygosityHeterozygous
Amino Acid Change Glutamic Acid to Glycine at position 283 (E283G)
Ref Sequence ENSEMBL: ENSMUSP00000077132 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000061673]
Predicted Effect probably damaging
Transcript: ENSMUST00000061673
AA Change: E283G

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000077132
Gene: ENSMUSG00000042284
AA Change: E283G

DomainStartEndE-ValueType
Int_alpha 43 96 1.63e0 SMART
VWA 170 360 4.24e-44 SMART
Int_alpha 432 481 4.21e-3 SMART
Int_alpha 485 542 3.19e-12 SMART
Int_alpha 566 621 1.79e-15 SMART
Int_alpha 628 682 3.04e1 SMART
low complexity region 1108 1122 N/A INTRINSIC
PDB:2L8S|A 1135 1179 5e-10 PDB
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.7%
  • 20x: 99.2%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes the alpha 1 subunit of integrin receptors. This protein heterodimerizes with the beta 1 subunit to form a cell-surface receptor for collagen and laminin. The heterodimeric receptor is involved in cell-cell adhesion and may play a role in inflammation and fibrosis. The alpha 1 subunit contains an inserted (I) von Willebrand factor type I domain which is thought to be involved in collagen binding. [provided by RefSeq, Jul 2008]
PHENOTYPE: Mice homozygous for disruptions in this gene are essentially normal although their kidneys are smaller and more succeptible to injury. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 47 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Ankle1 T C 8: 71,408,693 S391P probably damaging Het
Ankmy1 T C 1: 92,883,848 Q606R probably benign Het
Bmf A G 2: 118,546,877 L130P probably damaging Het
Ccdc88c G A 12: 100,923,311 T1491I probably benign Het
Cyp2c69 G A 19: 39,876,219 R272C probably benign Het
Defa27 A G 8: 21,316,338 N78S probably benign Het
Depdc5 T A 5: 32,944,103 D912E probably damaging Het
Dsc3 C T 18: 19,966,231 D743N probably damaging Het
Epcam T C 17: 87,643,555 V190A probably benign Het
Exoc2 G A 13: 30,876,773 R583* probably null Het
Extl1 T A 4: 134,364,679 I288F probably damaging Het
Fam208a T C 14: 27,481,383 S289P Het
Fam50b G A 13: 34,747,101 E187K possibly damaging Het
Fcer2a T A 8: 3,682,910 Y299F probably benign Het
Frmd4a G A 2: 4,590,695 G439R probably damaging Het
Gal3st4 T C 5: 138,270,838 H120R probably benign Het
Grid1 C A 14: 35,321,685 N332K probably damaging Het
Igkv4-68 A G 6: 69,304,912 Y92H probably damaging Het
Ldlrad1 G A 4: 107,209,491 A8T probably benign Het
Lrrc24 A G 15: 76,718,048 L169P probably benign Het
Mcidas G A 13: 112,998,987 G315S probably damaging Het
Mettl8 T C 2: 70,981,899 T131A probably benign Het
Miip C T 4: 147,862,918 G236S probably benign Het
Nbr1 T A 11: 101,569,328 D383E probably damaging Het
Neto1 A T 18: 86,461,073 K167N probably benign Het
Nkx6-1 A T 5: 101,663,762 L158Q unknown Het
Nlrp5 G A 7: 23,418,794 V648M possibly damaging Het
Nvl G T 1: 181,097,157 Q811K probably benign Het
Olfr1341 C A 4: 118,709,658 H84N possibly damaging Het
Olfr338 A G 2: 36,377,441 T222A probably benign Het
Olfr402 T A 11: 74,156,018 L288Q probably damaging Het
Olfr532 A G 7: 140,419,114 F220L possibly damaging Het
Pccb T C 9: 100,999,263 Y224C probably damaging Het
Pcdh10 T C 3: 45,380,222 Y324H probably benign Het
Pecam1 C A 11: 106,695,832 E286* probably null Het
Prl7d1 A T 13: 27,709,280 L215Q probably damaging Het
Ranbp2 T A 10: 58,483,907 Y2514* probably null Het
Rgs11 A G 17: 26,207,578 H261R possibly damaging Het
Samd15 A G 12: 87,200,732 T64A probably benign Het
Shc4 T A 2: 125,723,365 S5C probably damaging Het
Shroom3 G A 5: 92,919,649 V109M probably damaging Het
Spata13 T C 14: 60,691,842 I283T possibly damaging Het
Sptbn2 C G 19: 4,749,012 R2037G probably benign Het
Synj2bp G A 12: 81,502,148 P106S probably benign Het
Thoc1 T C 18: 9,986,300 V344A probably damaging Het
Vmn1r71 A G 7: 10,748,209 L184S probably damaging Het
Vps45 A G 3: 96,019,624 I537T probably benign Het
Other mutations in Itga1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00264:Itga1 APN 13 114992363 missense possibly damaging 0.80
IGL00498:Itga1 APN 13 115031193 missense probably benign 0.00
IGL00549:Itga1 APN 13 115049296 missense possibly damaging 0.92
IGL00587:Itga1 APN 13 115012249 missense probably damaging 1.00
IGL01021:Itga1 APN 13 114997000 missense probably benign 0.29
IGL01289:Itga1 APN 13 114986226 missense possibly damaging 0.79
IGL01636:Itga1 APN 13 115006948 missense possibly damaging 0.73
IGL01791:Itga1 APN 13 114987661 missense probably benign 0.00
IGL01796:Itga1 APN 13 114985121 missense probably damaging 1.00
IGL02027:Itga1 APN 13 114990055 splice site probably null
IGL02330:Itga1 APN 13 115012204 missense probably damaging 1.00
IGL02480:Itga1 APN 13 114987648 missense probably damaging 1.00
IGL02943:Itga1 APN 13 115049296 missense possibly damaging 0.92
R0103:Itga1 UTSW 13 115016254 missense probably benign 0.40
R0103:Itga1 UTSW 13 115016254 missense probably benign 0.40
R0244:Itga1 UTSW 13 115006897 splice site probably benign
R0265:Itga1 UTSW 13 114992459 missense probably benign
R0302:Itga1 UTSW 13 115012318 splice site probably benign
R0320:Itga1 UTSW 13 114977594 splice site probably benign
R0389:Itga1 UTSW 13 114992460 missense probably benign 0.04
R0443:Itga1 UTSW 13 114992460 missense probably benign 0.04
R0574:Itga1 UTSW 13 114966561 missense probably damaging 1.00
R0646:Itga1 UTSW 13 114968299 missense probably benign
R0830:Itga1 UTSW 13 115007032 missense probably benign 0.08
R2162:Itga1 UTSW 13 115030910 missense probably benign 0.23
R2216:Itga1 UTSW 13 114997029 missense probably benign 0.00
R2403:Itga1 UTSW 13 114977614 missense probably benign 0.00
R3734:Itga1 UTSW 13 114977639 missense probably benign
R4171:Itga1 UTSW 13 115030886 nonsense probably null
R4402:Itga1 UTSW 13 115001566 missense probably benign 0.00
R4675:Itga1 UTSW 13 115001691 splice site probably null
R4684:Itga1 UTSW 13 115049370 missense probably damaging 1.00
R4795:Itga1 UTSW 13 115035385 missense probably damaging 1.00
R4796:Itga1 UTSW 13 115035385 missense probably damaging 1.00
R4845:Itga1 UTSW 13 114974172 nonsense probably null
R5147:Itga1 UTSW 13 114985142 missense possibly damaging 0.91
R5155:Itga1 UTSW 13 115035303 missense probably benign
R5234:Itga1 UTSW 13 115049303 nonsense probably null
R5344:Itga1 UTSW 13 115002309 missense possibly damaging 0.78
R5554:Itga1 UTSW 13 114992474 nonsense probably null
R5662:Itga1 UTSW 13 114986171 missense probably benign 0.03
R5945:Itga1 UTSW 13 114966590 missense probably benign 0.02
R6150:Itga1 UTSW 13 114968233 missense probably benign 0.01
R6241:Itga1 UTSW 13 114960137 splice site probably null
R6276:Itga1 UTSW 13 114980852 missense probably benign
R6369:Itga1 UTSW 13 114965660 missense probably damaging 1.00
R6511:Itga1 UTSW 13 114992501 missense probably damaging 0.98
R6663:Itga1 UTSW 13 114974105 missense probably benign 0.02
R6783:Itga1 UTSW 13 114996977 missense probably benign 0.22
R6931:Itga1 UTSW 13 115001563 missense probably benign 0.39
R7069:Itga1 UTSW 13 114968240 missense probably damaging 1.00
R7458:Itga1 UTSW 13 114986266 missense probably benign 0.00
R7588:Itga1 UTSW 13 114968249 missense possibly damaging 0.88
R7591:Itga1 UTSW 13 114982779 missense probably damaging 1.00
R7597:Itga1 UTSW 13 114974140 missense probably benign 0.28
R7615:Itga1 UTSW 13 114996922 missense probably null 0.99
R7756:Itga1 UTSW 13 114992460 missense probably benign 0.04
R7819:Itga1 UTSW 13 115049301 missense probably damaging 0.99
Z1177:Itga1 UTSW 13 114985071 critical splice donor site probably null
Predicted Primers PCR Primer
(F):5'- AGGGCTACAGAAATACCACG -3'
(R):5'- AGGCTGTGCAGAATGGCTATAC -3'

Sequencing Primer
(F):5'- AAGATATCTTCTGAACCTGGCTTC -3'
(R):5'- CTGTGCAGAATGGCTATACTCTTG -3'
Posted On2019-11-26