Incidental Mutation 'R7795:Lrrc24'
ID600194
Institutional Source Beutler Lab
Gene Symbol Lrrc24
Ensembl Gene ENSMUSG00000033707
Gene Nameleucine rich repeat containing 24
Synonyms
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.082) question?
Stock #R7795 (G1)
Quality Score225.009
Status Not validated
Chromosome15
Chromosomal Location76715276-76722173 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 76718048 bp
ZygosityHeterozygous
Amino Acid Change Leucine to Proline at position 169 (L169P)
Ref Sequence ENSEMBL: ENSMUSP00000061906 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000036247] [ENSMUST00000036423] [ENSMUST00000049956] [ENSMUST00000127208] [ENSMUST00000136840] [ENSMUST00000137649] [ENSMUST00000142610] [ENSMUST00000155735] [ENSMUST00000228990]
Predicted Effect probably benign
Transcript: ENSMUST00000036247
SMART Domains Protein: ENSMUSP00000039910
Gene: ENSMUSG00000116138

DomainStartEndE-ValueType
Pfam:DUF4505 31 209 5.4e-84 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000036423
SMART Domains Protein: ENSMUSP00000049466
Gene: ENSMUSG00000033728

DomainStartEndE-ValueType
low complexity region 23 35 N/A INTRINSIC
low complexity region 55 66 N/A INTRINSIC
SCOP:d1a4ya_ 222 413 2e-13 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000049956
AA Change: L169P

PolyPhen 2 Score 0.427 (Sensitivity: 0.89; Specificity: 0.90)
SMART Domains Protein: ENSMUSP00000061906
Gene: ENSMUSG00000033707
AA Change: L169P

DomainStartEndE-ValueType
signal peptide 1 23 N/A INTRINSIC
LRRNT 30 62 1.04e-2 SMART
LRR 61 80 3.18e2 SMART
LRR_TYP 81 104 2.99e-4 SMART
LRR 106 128 3.87e1 SMART
LRR_TYP 129 152 8.22e-2 SMART
LRR_TYP 153 176 5.06e-2 SMART
LRR 177 200 2.02e-1 SMART
LRRCT 212 266 2e-10 SMART
IGc2 280 360 1.02e-9 SMART
transmembrane domain 409 431 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000127208
SMART Domains Protein: ENSMUSP00000114921
Gene: ENSMUSG00000033728

DomainStartEndE-ValueType
low complexity region 23 35 N/A INTRINSIC
low complexity region 55 66 N/A INTRINSIC
SCOP:d1a4ya_ 222 413 2e-13 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000136840
SMART Domains Protein: ENSMUSP00000119670
Gene: ENSMUSG00000033728

DomainStartEndE-ValueType
low complexity region 23 35 N/A INTRINSIC
low complexity region 55 66 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000137649
SMART Domains Protein: ENSMUSP00000121982
Gene: ENSMUSG00000033728

DomainStartEndE-ValueType
low complexity region 23 35 N/A INTRINSIC
low complexity region 55 66 N/A INTRINSIC
SCOP:d1a4ya_ 222 413 2e-13 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000142610
SMART Domains Protein: ENSMUSP00000117780
Gene: ENSMUSG00000033728

DomainStartEndE-ValueType
low complexity region 23 35 N/A INTRINSIC
low complexity region 55 66 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000155735
SMART Domains Protein: ENSMUSP00000115446
Gene: ENSMUSG00000033728

DomainStartEndE-ValueType
low complexity region 23 35 N/A INTRINSIC
low complexity region 55 66 N/A INTRINSIC
SCOP:d1a4ya_ 222 413 2e-13 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000228990
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.7%
  • 20x: 99.2%
Validation Efficiency
Allele List at MGI
Other mutations in this stock
Total: 47 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Ankle1 T C 8: 71,408,693 S391P probably damaging Het
Ankmy1 T C 1: 92,883,848 Q606R probably benign Het
Bmf A G 2: 118,546,877 L130P probably damaging Het
Ccdc88c G A 12: 100,923,311 T1491I probably benign Het
Cyp2c69 G A 19: 39,876,219 R272C probably benign Het
Defa27 A G 8: 21,316,338 N78S probably benign Het
Depdc5 T A 5: 32,944,103 D912E probably damaging Het
Dsc3 C T 18: 19,966,231 D743N probably damaging Het
Epcam T C 17: 87,643,555 V190A probably benign Het
Exoc2 G A 13: 30,876,773 R583* probably null Het
Extl1 T A 4: 134,364,679 I288F probably damaging Het
Fam208a T C 14: 27,481,383 S289P Het
Fam50b G A 13: 34,747,101 E187K possibly damaging Het
Fcer2a T A 8: 3,682,910 Y299F probably benign Het
Frmd4a G A 2: 4,590,695 G439R probably damaging Het
Gal3st4 T C 5: 138,270,838 H120R probably benign Het
Grid1 C A 14: 35,321,685 N332K probably damaging Het
Igkv4-68 A G 6: 69,304,912 Y92H probably damaging Het
Itga1 T C 13: 115,012,236 E283G probably damaging Het
Ldlrad1 G A 4: 107,209,491 A8T probably benign Het
Mcidas G A 13: 112,998,987 G315S probably damaging Het
Mettl8 T C 2: 70,981,899 T131A probably benign Het
Miip C T 4: 147,862,918 G236S probably benign Het
Nbr1 T A 11: 101,569,328 D383E probably damaging Het
Neto1 A T 18: 86,461,073 K167N probably benign Het
Nkx6-1 A T 5: 101,663,762 L158Q unknown Het
Nlrp5 G A 7: 23,418,794 V648M possibly damaging Het
Nvl G T 1: 181,097,157 Q811K probably benign Het
Olfr1341 C A 4: 118,709,658 H84N possibly damaging Het
Olfr338 A G 2: 36,377,441 T222A probably benign Het
Olfr402 T A 11: 74,156,018 L288Q probably damaging Het
Olfr532 A G 7: 140,419,114 F220L possibly damaging Het
Pccb T C 9: 100,999,263 Y224C probably damaging Het
Pcdh10 T C 3: 45,380,222 Y324H probably benign Het
Pecam1 C A 11: 106,695,832 E286* probably null Het
Prl7d1 A T 13: 27,709,280 L215Q probably damaging Het
Ranbp2 T A 10: 58,483,907 Y2514* probably null Het
Rgs11 A G 17: 26,207,578 H261R possibly damaging Het
Samd15 A G 12: 87,200,732 T64A probably benign Het
Shc4 T A 2: 125,723,365 S5C probably damaging Het
Shroom3 G A 5: 92,919,649 V109M probably damaging Het
Spata13 T C 14: 60,691,842 I283T possibly damaging Het
Sptbn2 C G 19: 4,749,012 R2037G probably benign Het
Synj2bp G A 12: 81,502,148 P106S probably benign Het
Thoc1 T C 18: 9,986,300 V344A probably damaging Het
Vmn1r71 A G 7: 10,748,209 L184S probably damaging Het
Vps45 A G 3: 96,019,624 I537T probably benign Het
Other mutations in Lrrc24
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00519:Lrrc24 APN 15 76718063 missense probably damaging 1.00
IGL01556:Lrrc24 APN 15 76722575 missense probably damaging 0.99
IGL01940:Lrrc24 APN 15 76716057 missense probably damaging 1.00
IGL01966:Lrrc24 APN 15 76718311 missense probably benign 0.22
IGL02315:Lrrc24 APN 15 76718306 missense probably damaging 1.00
IGL03062:Lrrc24 APN 15 76718304 missense probably benign
R0240:Lrrc24 UTSW 15 76723209 missense probably damaging 1.00
R0240:Lrrc24 UTSW 15 76723209 missense probably damaging 1.00
R0365:Lrrc24 UTSW 15 76715784 missense probably benign 0.14
R1430:Lrrc24 UTSW 15 76723792 unclassified probably null
R1789:Lrrc24 UTSW 15 76722578 missense probably benign 0.02
R2131:Lrrc24 UTSW 15 76715581 missense possibly damaging 0.92
R2202:Lrrc24 UTSW 15 76722911 missense probably damaging 1.00
R4247:Lrrc24 UTSW 15 76717976 missense possibly damaging 0.89
R4585:Lrrc24 UTSW 15 76723689 missense probably damaging 1.00
R4944:Lrrc24 UTSW 15 76718346 missense probably damaging 1.00
R4976:Lrrc24 UTSW 15 76716000 missense probably benign 0.00
R5119:Lrrc24 UTSW 15 76716000 missense probably benign 0.00
R5445:Lrrc24 UTSW 15 76716106 missense probably benign 0.10
R5772:Lrrc24 UTSW 15 76722710 missense probably damaging 1.00
X0028:Lrrc24 UTSW 15 76715913 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- CCACGGCTGACAATAGGAAC -3'
(R):5'- CTGCCGGTAAGCTACAAACG -3'

Sequencing Primer
(F):5'- TAGGAACCCACTGTGTACCTAAG -3'
(R):5'- AAACGCCAACACTTCTGTATCTTG -3'
Posted On2019-11-26