Incidental Mutation 'R7795:Epcam'
ID600196
Institutional Source Beutler Lab
Gene Symbol Epcam
Ensembl Gene ENSMUSG00000045394
Gene Nameepithelial cell adhesion molecule
SynonymsGA733-2, Egp314, EpCAM, gp40, Ly74, EGP-2, CD326, panepithelial glycoprotein 314, TROP1, Ep-CAM, EpCAM1, Tacstd1
MMRRC Submission
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R7795 (G1)
Quality Score225.009
Status Not validated
Chromosome17
Chromosomal Location87635979-87651106 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 87643555 bp
ZygosityHeterozygous
Amino Acid Change Valine to Alanine at position 190 (V190A)
Ref Sequence ENSEMBL: ENSMUSP00000061935 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000053577]
Predicted Effect probably benign
Transcript: ENSMUST00000053577
AA Change: V190A

PolyPhen 2 Score 0.077 (Sensitivity: 0.93; Specificity: 0.85)
SMART Domains Protein: ENSMUSP00000061935
Gene: ENSMUSG00000045394
AA Change: V190A

DomainStartEndE-ValueType
signal peptide 1 23 N/A INTRINSIC
TY 96 139 3.96e-8 SMART
transmembrane domain 267 289 N/A INTRINSIC
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.7%
  • 20x: 99.2%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a carcinoma-associated antigen and is a member of a family that includes at least two type I membrane proteins. This antigen is expressed on most normal epithelial cells and gastrointestinal carcinomas and functions as a homotypic calcium-independent cell adhesion molecule. The antigen is being used as a target for immunotherapy treatment of human carcinomas. Mutations in this gene result in congenital tufting enteropathy. [provided by RefSeq, Dec 2008]
PHENOTYPE: Homozygous null mice display embryonic lethality during organogenesis with decreased embryo size, impaired labyrinth layer development and decreased number of trophoblast giant cells. Mice homozygous for another knock-out allele exhibit impaired intestinal tight junctions with lethality. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 47 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Ankle1 T C 8: 71,408,693 S391P probably damaging Het
Ankmy1 T C 1: 92,883,848 Q606R probably benign Het
Bmf A G 2: 118,546,877 L130P probably damaging Het
Ccdc88c G A 12: 100,923,311 T1491I probably benign Het
Cyp2c69 G A 19: 39,876,219 R272C probably benign Het
Defa27 A G 8: 21,316,338 N78S probably benign Het
Depdc5 T A 5: 32,944,103 D912E probably damaging Het
Dsc3 C T 18: 19,966,231 D743N probably damaging Het
Exoc2 G A 13: 30,876,773 R583* probably null Het
Extl1 T A 4: 134,364,679 I288F probably damaging Het
Fam208a T C 14: 27,481,383 S289P Het
Fam50b G A 13: 34,747,101 E187K possibly damaging Het
Fcer2a T A 8: 3,682,910 Y299F probably benign Het
Frmd4a G A 2: 4,590,695 G439R probably damaging Het
Gal3st4 T C 5: 138,270,838 H120R probably benign Het
Grid1 C A 14: 35,321,685 N332K probably damaging Het
Igkv4-68 A G 6: 69,304,912 Y92H probably damaging Het
Itga1 T C 13: 115,012,236 E283G probably damaging Het
Ldlrad1 G A 4: 107,209,491 A8T probably benign Het
Lrrc24 A G 15: 76,718,048 L169P probably benign Het
Mcidas G A 13: 112,998,987 G315S probably damaging Het
Mettl8 T C 2: 70,981,899 T131A probably benign Het
Miip C T 4: 147,862,918 G236S probably benign Het
Nbr1 T A 11: 101,569,328 D383E probably damaging Het
Neto1 A T 18: 86,461,073 K167N probably benign Het
Nkx6-1 A T 5: 101,663,762 L158Q unknown Het
Nlrp5 G A 7: 23,418,794 V648M possibly damaging Het
Nvl G T 1: 181,097,157 Q811K probably benign Het
Olfr1341 C A 4: 118,709,658 H84N possibly damaging Het
Olfr338 A G 2: 36,377,441 T222A probably benign Het
Olfr402 T A 11: 74,156,018 L288Q probably damaging Het
Olfr532 A G 7: 140,419,114 F220L possibly damaging Het
Pccb T C 9: 100,999,263 Y224C probably damaging Het
Pcdh10 T C 3: 45,380,222 Y324H probably benign Het
Pecam1 C A 11: 106,695,832 E286* probably null Het
Prl7d1 A T 13: 27,709,280 L215Q probably damaging Het
Ranbp2 T A 10: 58,483,907 Y2514* probably null Het
Rgs11 A G 17: 26,207,578 H261R possibly damaging Het
Samd15 A G 12: 87,200,732 T64A probably benign Het
Shc4 T A 2: 125,723,365 S5C probably damaging Het
Shroom3 G A 5: 92,919,649 V109M probably damaging Het
Spata13 T C 14: 60,691,842 I283T possibly damaging Het
Sptbn2 C G 19: 4,749,012 R2037G probably benign Het
Synj2bp G A 12: 81,502,148 P106S probably benign Het
Thoc1 T C 18: 9,986,300 V344A probably damaging Het
Vmn1r71 A G 7: 10,748,209 L184S probably damaging Het
Vps45 A G 3: 96,019,624 I537T probably benign Het
Other mutations in Epcam
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL02739:Epcam APN 17 87640494 missense probably benign 0.30
R0664:Epcam UTSW 17 87639970 missense possibly damaging 0.86
R1612:Epcam UTSW 17 87639938 missense possibly damaging 0.87
R1693:Epcam UTSW 17 87639896 missense probably benign
R1719:Epcam UTSW 17 87642128 missense probably damaging 1.00
R1998:Epcam UTSW 17 87640474 missense probably damaging 1.00
R3872:Epcam UTSW 17 87639926 missense possibly damaging 0.79
R4297:Epcam UTSW 17 87640534 splice site probably null
R4298:Epcam UTSW 17 87640534 splice site probably null
R4866:Epcam UTSW 17 87643621 missense possibly damaging 0.79
R4900:Epcam UTSW 17 87643621 missense possibly damaging 0.79
R5091:Epcam UTSW 17 87642152 missense probably damaging 1.00
R5301:Epcam UTSW 17 87636877 missense possibly damaging 0.92
R6207:Epcam UTSW 17 87640436 missense probably damaging 1.00
R7576:Epcam UTSW 17 87640293 missense probably damaging 1.00
R7751:Epcam UTSW 17 87640476 nonsense probably null
R8022:Epcam UTSW 17 87646308 missense probably benign 0.02
Predicted Primers PCR Primer
(F):5'- AGCTGTTTGCATTGCTAGTTTACTC -3'
(R):5'- GGAAGGGTAATTTCATAGCATCTGC -3'

Sequencing Primer
(F):5'- TTGCATTGCTAGTTTACTCTCTTAG -3'
(R):5'- TATCTTGAGTGCCAGGACAGC -3'
Posted On2019-11-26