Incidental Mutation 'R7795:Sptbn2'
ID 600200
Institutional Source Beutler Lab
Gene Symbol Sptbn2
Ensembl Gene ENSMUSG00000067889
Gene Name spectrin beta, non-erythrocytic 2
Synonyms Spnb3
MMRRC Submission
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock # R7795 (G1)
Quality Score 225.009
Status Not validated
Chromosome 19
Chromosomal Location 4711208-4752353 bp(+) (GRCm38)
Type of Mutation missense
DNA Base Change (assembly) C to G at 4749012 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change Arginine to Glycine at position 2037 (R2037G)
Ref Sequence ENSEMBL: ENSMUSP00000008991 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000008991] [ENSMUST00000178353]
AlphaFold Q68FG2
Predicted Effect probably benign
Transcript: ENSMUST00000008991
AA Change: R2037G

PolyPhen 2 Score 0.051 (Sensitivity: 0.94; Specificity: 0.83)
SMART Domains Protein: ENSMUSP00000008991
Gene: ENSMUSG00000067889
AA Change: R2037G

DomainStartEndE-ValueType
CH 59 159 1.86e-28 SMART
CH 178 276 2.86e-20 SMART
SPEC 308 414 4.63e-1 SMART
SPEC 428 528 3.07e-23 SMART
SPEC 534 638 4.47e-25 SMART
SPEC 644 744 1.28e-25 SMART
SPEC 750 849 4.98e-23 SMART
SPEC 855 955 1.63e-18 SMART
SPEC 961 1062 1.45e-24 SMART
SPEC 1068 1169 4.15e-20 SMART
SPEC 1175 1275 5.26e-22 SMART
SPEC 1281 1380 1.17e-19 SMART
SPEC 1386 1485 2.06e-24 SMART
SPEC 1491 1585 1.74e-22 SMART
SPEC 1591 1691 5.42e-24 SMART
SPEC 1697 1798 2.1e-21 SMART
SPEC 1804 1904 5.47e-20 SMART
SPEC 1910 2010 1.99e-22 SMART
SPEC 2016 2256 2.92e-6 SMART
PH 2219 2330 1.65e-14 SMART
low complexity region 2373 2386 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000178353
SMART Domains Protein: ENSMUSP00000136599
Gene: ENSMUSG00000096370

DomainStartEndE-ValueType
RRM 2 69 1.96e-17 SMART
Pfam:RRM_1 81 118 5.6e-7 PFAM
Meta Mutation Damage Score 0.1824 question?
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.7%
  • 20x: 99.2%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] Spectrins are principle components of a cell's membrane-cytoskeleton and are composed of two alpha and two beta spectrin subunits. The protein encoded by this gene (SPTBN2), is called spectrin beta non-erythrocytic 2 or beta-III spectrin. It is related to, but distinct from, the beta-II spectrin gene which is also known as spectrin beta non-erythrocytic 1 (SPTBN1). SPTBN2 regulates the glutamate signaling pathway by stabilizing the glutamate transporter EAAT4 at the surface of the plasma membrane. Mutations in this gene cause a form of spinocerebellar ataxia, SCA5, that is characterized by neurodegeneration, progressive locomotor incoordination, dysarthria, and uncoordinated eye movements. [provided by RefSeq, Dec 2009]
PHENOTYPE: Homozygous hypomorphic mutants exhibit a progressive ataxic phenotype with gait abnormalities, tremor, deteriorating motor coordination, Purkinje cell loss, and cerebellar atrophy (molecular layer thinning) and age-related reduction in simple firing ratein surviving Purkinje cells. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 47 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Ankle1 T C 8: 71,408,693 S391P probably damaging Het
Ankmy1 T C 1: 92,883,848 Q606R probably benign Het
Bmf A G 2: 118,546,877 L130P probably damaging Het
Ccdc88c G A 12: 100,923,311 T1491I probably benign Het
Cyp2c69 G A 19: 39,876,219 R272C probably benign Het
Defa27 A G 8: 21,316,338 N78S probably benign Het
Depdc5 T A 5: 32,944,103 D912E probably damaging Het
Dsc3 C T 18: 19,966,231 D743N probably damaging Het
Epcam T C 17: 87,643,555 V190A probably benign Het
Exoc2 G A 13: 30,876,773 R583* probably null Het
Extl1 T A 4: 134,364,679 I288F probably damaging Het
Fam208a T C 14: 27,481,383 S289P Het
Fam50b G A 13: 34,747,101 E187K possibly damaging Het
Fcer2a T A 8: 3,682,910 Y299F probably benign Het
Frmd4a G A 2: 4,590,695 G439R probably damaging Het
Gal3st4 T C 5: 138,270,838 H120R probably benign Het
Grid1 C A 14: 35,321,685 N332K probably damaging Het
Igkv4-68 A G 6: 69,304,912 Y92H probably damaging Het
Itga1 T C 13: 115,012,236 E283G probably damaging Het
Ldlrad1 G A 4: 107,209,491 A8T probably benign Het
Lrrc24 A G 15: 76,718,048 L169P probably benign Het
Mcidas G A 13: 112,998,987 G315S probably damaging Het
Mettl8 T C 2: 70,981,899 T131A probably benign Het
Miip C T 4: 147,862,918 G236S probably benign Het
Nbr1 T A 11: 101,569,328 D383E probably damaging Het
Neto1 A T 18: 86,461,073 K167N probably benign Het
Nkx6-1 A T 5: 101,663,762 L158Q unknown Het
Nlrp5 G A 7: 23,418,794 V648M possibly damaging Het
Nvl G T 1: 181,097,157 Q811K probably benign Het
Olfr1341 C A 4: 118,709,658 H84N possibly damaging Het
Olfr338 A G 2: 36,377,441 T222A probably benign Het
Olfr402 T A 11: 74,156,018 L288Q probably damaging Het
Olfr532 A G 7: 140,419,114 F220L possibly damaging Het
Pccb T C 9: 100,999,263 Y224C probably damaging Het
Pcdh10 T C 3: 45,380,222 Y324H probably benign Het
Pecam1 C A 11: 106,695,832 E286* probably null Het
Prl7d1 A T 13: 27,709,280 L215Q probably damaging Het
Ranbp2 T A 10: 58,483,907 Y2514* probably null Het
Rgs11 A G 17: 26,207,578 H261R possibly damaging Het
Samd15 A G 12: 87,200,732 T64A probably benign Het
Shc4 T A 2: 125,723,365 S5C probably damaging Het
Shroom3 G A 5: 92,919,649 V109M probably damaging Het
Spata13 T C 14: 60,691,842 I283T possibly damaging Het
Synj2bp G A 12: 81,502,148 P106S probably benign Het
Thoc1 T C 18: 9,986,300 V344A probably damaging Het
Vmn1r71 A G 7: 10,748,209 L184S probably damaging Het
Vps45 A G 3: 96,019,624 I537T probably benign Het
Other mutations in Sptbn2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00421:Sptbn2 APN 19 4724705 missense possibly damaging 0.94
IGL00688:Sptbn2 APN 19 4725938 missense probably damaging 1.00
IGL01339:Sptbn2 APN 19 4745972 nonsense probably null
IGL01373:Sptbn2 APN 19 4745972 nonsense probably null
IGL01420:Sptbn2 APN 19 4734125 missense probably benign
IGL01456:Sptbn2 APN 19 4746749 missense probably damaging 1.00
IGL01953:Sptbn2 APN 19 4749693 missense probably benign
IGL03026:Sptbn2 APN 19 4724233 critical splice donor site probably null
IGL03275:Sptbn2 APN 19 4732661 missense possibly damaging 0.65
IGL03286:Sptbn2 APN 19 4747832 missense probably damaging 0.97
F5770:Sptbn2 UTSW 19 4750632 missense probably damaging 1.00
PIT4696001:Sptbn2 UTSW 19 4745577 missense probably benign 0.00
R0046:Sptbn2 UTSW 19 4745377 intron probably benign
R0046:Sptbn2 UTSW 19 4745377 intron probably benign
R0121:Sptbn2 UTSW 19 4745293 missense probably damaging 1.00
R0127:Sptbn2 UTSW 19 4724744 missense probably damaging 1.00
R0212:Sptbn2 UTSW 19 4746942 critical splice donor site probably null
R0277:Sptbn2 UTSW 19 4745145 missense probably benign 0.28
R0417:Sptbn2 UTSW 19 4737926 missense probably benign 0.01
R0457:Sptbn2 UTSW 19 4745938 missense possibly damaging 0.89
R0536:Sptbn2 UTSW 19 4726690 missense probably damaging 0.99
R0631:Sptbn2 UTSW 19 4739986 missense probably benign 0.01
R0734:Sptbn2 UTSW 19 4748123 nonsense probably null
R0742:Sptbn2 UTSW 19 4718983 missense possibly damaging 0.46
R1195:Sptbn2 UTSW 19 4745893 missense possibly damaging 0.85
R1195:Sptbn2 UTSW 19 4745893 missense possibly damaging 0.85
R1195:Sptbn2 UTSW 19 4745893 missense possibly damaging 0.85
R1364:Sptbn2 UTSW 19 4732665 missense probably damaging 1.00
R1495:Sptbn2 UTSW 19 4718976 missense possibly damaging 0.92
R1498:Sptbn2 UTSW 19 4744246 missense possibly damaging 0.94
R1606:Sptbn2 UTSW 19 4750242 critical splice donor site probably null
R1678:Sptbn2 UTSW 19 4750497 missense probably damaging 1.00
R1746:Sptbn2 UTSW 19 4745964 nonsense probably null
R1820:Sptbn2 UTSW 19 4726596 missense probably damaging 0.98
R1830:Sptbn2 UTSW 19 4732541 missense probably benign 0.09
R1863:Sptbn2 UTSW 19 4732685 missense possibly damaging 0.54
R1967:Sptbn2 UTSW 19 4745299 missense probably benign 0.00
R2085:Sptbn2 UTSW 19 4738559 missense probably benign 0.09
R2301:Sptbn2 UTSW 19 4734138 missense probably benign 0.00
R2310:Sptbn2 UTSW 19 4718935 missense probably benign 0.19
R2888:Sptbn2 UTSW 19 4748636 missense possibly damaging 0.52
R3788:Sptbn2 UTSW 19 4745922 missense probably damaging 1.00
R4429:Sptbn2 UTSW 19 4738355 missense probably damaging 1.00
R4536:Sptbn2 UTSW 19 4732602 missense probably damaging 1.00
R4662:Sptbn2 UTSW 19 4739239 missense probably damaging 1.00
R4672:Sptbn2 UTSW 19 4732496 missense probably benign 0.25
R4731:Sptbn2 UTSW 19 4742480 missense probably damaging 0.96
R4747:Sptbn2 UTSW 19 4748154 missense probably benign 0.27
R4889:Sptbn2 UTSW 19 4729430 missense possibly damaging 0.69
R4891:Sptbn2 UTSW 19 4738469 missense probably damaging 1.00
R4965:Sptbn2 UTSW 19 4729309 missense probably benign 0.13
R4968:Sptbn2 UTSW 19 4729202 splice site probably null
R4981:Sptbn2 UTSW 19 4751658 missense probably benign 0.22
R5159:Sptbn2 UTSW 19 4737857 missense probably benign 0.12
R5202:Sptbn2 UTSW 19 4724184 missense probably damaging 1.00
R5253:Sptbn2 UTSW 19 4750082 missense probably benign 0.01
R5294:Sptbn2 UTSW 19 4718908 missense possibly damaging 0.67
R5465:Sptbn2 UTSW 19 4750105 missense probably benign 0.00
R5546:Sptbn2 UTSW 19 4725950 missense probably damaging 1.00
R5593:Sptbn2 UTSW 19 4748947 missense probably damaging 1.00
R5780:Sptbn2 UTSW 19 4724667 missense probably damaging 1.00
R5835:Sptbn2 UTSW 19 4738219 missense probably damaging 1.00
R6008:Sptbn2 UTSW 19 4739278 missense possibly damaging 0.89
R6108:Sptbn2 UTSW 19 4731392 critical splice donor site probably null
R6236:Sptbn2 UTSW 19 4748138 missense probably benign 0.01
R6307:Sptbn2 UTSW 19 4724646 missense probably damaging 1.00
R6383:Sptbn2 UTSW 19 4732496 missense possibly damaging 0.89
R6397:Sptbn2 UTSW 19 4742418 missense possibly damaging 0.91
R6453:Sptbn2 UTSW 19 4744180 missense possibly damaging 0.67
R6561:Sptbn2 UTSW 19 4747926 missense probably benign 0.39
R6564:Sptbn2 UTSW 19 4732024 missense probably damaging 1.00
R6644:Sptbn2 UTSW 19 4749012 missense probably benign 0.05
R6703:Sptbn2 UTSW 19 4749814 missense probably benign
R6703:Sptbn2 UTSW 19 4749815 missense probably benign
R6753:Sptbn2 UTSW 19 4747785 missense probably benign 0.01
R7007:Sptbn2 UTSW 19 4744145 missense possibly damaging 0.82
R7131:Sptbn2 UTSW 19 4749460 missense probably null
R7219:Sptbn2 UTSW 19 4724173 missense probably damaging 1.00
R7285:Sptbn2 UTSW 19 4737443 missense probably benign 0.00
R7308:Sptbn2 UTSW 19 4751574 missense probably benign
R7469:Sptbn2 UTSW 19 4745118 missense probably benign 0.00
R7502:Sptbn2 UTSW 19 4748082 missense probably benign 0.02
R7623:Sptbn2 UTSW 19 4726168 missense probably damaging 1.00
R7635:Sptbn2 UTSW 19 4744207 missense probably damaging 1.00
R7733:Sptbn2 UTSW 19 4749012 missense probably benign 0.05
R7738:Sptbn2 UTSW 19 4724125 missense probably damaging 1.00
R7742:Sptbn2 UTSW 19 4749012 missense probably benign 0.05
R7767:Sptbn2 UTSW 19 4734143 missense possibly damaging 0.62
R7796:Sptbn2 UTSW 19 4749012 missense probably benign 0.05
R7871:Sptbn2 UTSW 19 4749012 missense probably benign 0.05
R7877:Sptbn2 UTSW 19 4744262 missense possibly damaging 0.93
R7920:Sptbn2 UTSW 19 4749012 missense probably benign 0.05
R7921:Sptbn2 UTSW 19 4749012 missense probably benign 0.05
R7923:Sptbn2 UTSW 19 4746799 missense probably benign 0.01
R8137:Sptbn2 UTSW 19 4737403 missense possibly damaging 0.81
R8305:Sptbn2 UTSW 19 4729130 missense possibly damaging 0.81
R8695:Sptbn2 UTSW 19 4746696 missense possibly damaging 0.86
R8790:Sptbn2 UTSW 19 4732024 missense probably damaging 1.00
R9125:Sptbn2 UTSW 19 4734213 missense probably benign 0.04
R9483:Sptbn2 UTSW 19 4739946 missense probably damaging 1.00
R9620:Sptbn2 UTSW 19 4750507 missense probably damaging 0.99
R9631:Sptbn2 UTSW 19 4738190 missense probably damaging 1.00
R9646:Sptbn2 UTSW 19 4745313 missense probably damaging 1.00
R9694:Sptbn2 UTSW 19 4750507 missense probably damaging 0.99
V7580:Sptbn2 UTSW 19 4750632 missense probably damaging 1.00
Z1176:Sptbn2 UTSW 19 4738205 missense probably damaging 1.00
Z1176:Sptbn2 UTSW 19 4745191 missense probably benign 0.01
Predicted Primers PCR Primer
(F):5'- AACAACGCTGGTCTTTGTCCC -3'
(R):5'- AGCACTCTAAGCTCACATGC -3'

Sequencing Primer
(F):5'- CCTGTATTTGAGGTTGATCTGCCC -3'
(R):5'- TCTAAGCTCACATGCAGAGAG -3'
Posted On 2019-11-26