Mutagenetix > Incidental Mutations

Incidental Mutation 'R7796:Unc80'

600204

Institutional Source

Beutler Lab

Gene Symbol

Unc80

Ensembl Gene

ENSMUSG00000055567

Gene Name

unc-80, NALCN activator

Synonyms

C030018G13Rik, C230061B10Rik

MMRRC Submission

Accession Numbers

Is this an essential gene?

Probably essential (E-score: 0.933) question?

Stock #

R7796 (G1)

Quality Score

225.009

Status

Validated

Chromosome

Chromosomal Location

66468367-66699148 bp(+) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

A to G at 66503714 bp

Zygosity

Heterozygous

Amino Acid Change

Isoleucine to Valine at position 376 (I376V)

Ref Sequence

ENSEMBL: ENSMUSP00000053692 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000061620] [ENSMUST00000114008] [ENSMUST00000212557]

Predicted Effect

probably benign
Transcript: ENSMUST00000061620
AA Change: I376V

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)

SMART Domains

Protein: ENSMUSP00000053692
Gene: ENSMUSG00000055567
AA Change: I376V

Domain	Start	End	E-Value	Type
Pfam:UNC80	16	236	2.2e-94	PFAM
low complexity region	372	385	N/A	INTRINSIC
low complexity region	493	502	N/A	INTRINSIC
low complexity region	693	711	N/A	INTRINSIC
low complexity region	723	738	N/A	INTRINSIC
low complexity region	739	769	N/A	INTRINSIC
low complexity region	1038	1055	N/A	INTRINSIC
low complexity region	1067	1084	N/A	INTRINSIC
low complexity region	1309	1328	N/A	INTRINSIC
low complexity region	1477	1489	N/A	INTRINSIC
low complexity region	1676	1681	N/A	INTRINSIC
low complexity region	1842	1848	N/A	INTRINSIC
low complexity region	1854	1868	N/A	INTRINSIC
low complexity region	2461	2480	N/A	INTRINSIC
low complexity region	2726	2740	N/A	INTRINSIC
low complexity region	3121	3144	N/A	INTRINSIC
low complexity region	3245	3254	N/A	INTRINSIC

Predicted Effect

probably benign
Transcript: ENSMUST00000114008

Predicted Effect

probably benign
Transcript: ENSMUST00000212557
AA Change: I376V

PolyPhen 2 Score 0.044 (Sensitivity: 0.94; Specificity: 0.83)

Meta Mutation Damage Score

0.0585

Coding Region Coverage

1x: 100.0%
3x: 100.0%
10x: 99.8%
20x: 99.4%

Validation Efficiency

100% (54/54)

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene is a component of a voltage-independent 'leak' ion-channel complex, in which it performs essential functions, such as serving as a bridge between two other components (sodium leak channel non-selective and UNC79) and as a scaffold for Src kinases. Leak channels play an importnat role in establishment and maintenance of resting membrane potentials in neurons. Mutations in this gene are associated with congenital infantile encephalopathy, intellectual disability and growth issues. [provided by RefSeq, Aug 2016]

Allele List at MGI

Other mutations in this stock

Total: 57 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
A630089N07Rik	T	A	16: 98,065,824	I313F	probably benign	Het
Acot2	T	A	12: 83,988,483		probably null	Het
Agbl4	G	T	4: 110,660,968	G152V	unknown	Het
Arap2	A	G	5: 62,730,762	S414P	probably damaging	Het
C330021F23Rik	T	C	8: 3,584,160	V111A	probably benign	Het
Cep85l	A	C	10: 53,281,401	N735K	probably damaging	Het
Col12a1	T	C	9: 79,678,551	S1209G	possibly damaging	Het
Dennd1b	G	A	1: 139,062,873	E192K	probably damaging	Het
Dpf1	C	G	7: 29,311,681	N168K	possibly damaging	Het
Dync1li2	T	A	8: 104,430,549	Y184F	probably damaging	Het
Epb41l2	A	G	10: 25,443,829	T187A	probably benign	Het
Fam50b	G	A	13: 34,747,101	E187K	possibly damaging	Het
Fndc3b	G	A	3: 27,461,743	T638I	probably benign	Het
Gm11564	A	G	11: 99,815,598	V2A	unknown	Het
Gm13088	T	A	4: 143,654,157	D432V	possibly damaging	Het
Gm3159	A	G	14: 4,400,560	*206W	probably null	Het
Gm32742	A	G	9: 51,159,823		probably null	Het
Gm4847	G	A	1: 166,642,250	H85Y	probably damaging	Het
Gprc5c	A	T	11: 114,864,532	D345V	probably damaging	Het
Kalrn	A	T	16: 34,187,484	Y1363*	probably null	Het
Kdm5a	T	C	6: 120,390,763	V473A	probably damaging	Het
Kidins220	T	C	12: 24,982,351	C28R	probably damaging	Het
Klhl5	T	C	5: 65,164,622	Y664H	probably damaging	Het
Krt17	A	G	11: 100,260,872	S32P	probably benign	Het
Krt83	A	G	15: 101,485,984	V424A	possibly damaging	Het
Lipo1	T	C	19: 33,782,234	T201A	possibly damaging	Het
Map2	A	G	1: 66,416,495		probably null	Het
Megf10	C	A	18: 57,277,659	T680N	possibly damaging	Het
Metap1d	T	A	2: 71,512,162	D178E	probably damaging	Het
Miip	C	T	4: 147,862,918	G236S	probably benign	Het
Mki67	A	G	7: 135,698,194	S1704P	probably damaging	Het
Nr2f2	A	G	7: 70,358,153	S194P	probably benign	Het
Nrsn2	T	A	2: 152,376,551		probably benign	Het
Ociad1	C	T	5: 73,294,947	P27L	probably damaging	Het
Olfr1238	T	A	2: 89,406,813	T89S	possibly damaging	Het
Olfr1339	T	A	4: 118,734,685	I52N	probably damaging	Het
Patj	A	T	4: 98,546,983	M1L	probably benign	Het
Pcdhb2	A	G	18: 37,295,393	I140V	possibly damaging	Het
Pla2g6	T	C	15: 79,317,825	N49D	probably benign	Het
Pxdc1	T	A	13: 34,652,371	N22I	probably damaging	Het
Rpgrip1l	A	G	8: 91,270,237	Y672H	probably damaging	Het
Safb2	T	C	17: 56,566,327	R779G	possibly damaging	Het
Skiv2l	C	T	17: 34,844,418	G628S	probably damaging	Het
Smg5	A	T	3: 88,349,432	Q299L	probably damaging	Het
Sptbn2	C	G	19: 4,749,012	R2037G	probably benign	Het
Sulf1	T	C	1: 12,858,820	L864S	probably benign	Het
Tas1r1	A	G	4: 152,034,755	V119A	probably benign	Het
Tasp1	T	C	2: 140,008,785	N106S	probably damaging	Het
Tcf4	T	A	18: 69,564,069	N156K	probably benign	Het
Trav14n-3	T	A	14: 53,370,370	Y52*	probably null	Het
Ttn	T	C	2: 76,834,878	E11598G	unknown	Het
Ybx3	T	C	6: 131,368,516	E298G	probably damaging	Het
Yipf7	T	C	5: 69,527,253	Y73C	possibly damaging	Het
Zdbf2	G	A	1: 63,303,424	A321T	possibly damaging	Het
Zfp369	A	G	13: 65,296,215	R391G	probably benign	Het
Zfp54	A	G	17: 21,434,720	E492G	probably damaging	Het
Zfp971	A	G	2: 178,031,610	T51A	probably benign	Het

Other mutations in Unc80

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00160:Unc80	APN	1	66654395	missense	possibly damaging	0.53
IGL00340:Unc80	APN	1	66606459	missense	possibly damaging	0.73
IGL00783:Unc80	APN	1	66608437	missense	probably benign	0.37
IGL00784:Unc80	APN	1	66608437	missense	probably benign	0.37
IGL00935:Unc80	APN	1	66627266	missense	possibly damaging	0.53
IGL01094:Unc80	APN	1	66695433	missense	possibly damaging	0.90
IGL01466:Unc80	APN	1	66622486	missense	probably benign	0.33
IGL01577:Unc80	APN	1	66529968	splice site	probably null
IGL01626:Unc80	APN	1	66551054	critical splice donor site	probably null
IGL01640:Unc80	APN	1	66679585	missense	probably benign	0.33
IGL01775:Unc80	APN	1	66601056	missense	possibly damaging	0.94
IGL01960:Unc80	APN	1	66608500	splice site	probably benign
IGL01991:Unc80	APN	1	66469509	nonsense	probably null
IGL02022:Unc80	APN	1	66626516	missense	possibly damaging	0.53
IGL02073:Unc80	APN	1	66612227	missense	possibly damaging	0.85
IGL02077:Unc80	APN	1	66525716	missense	possibly damaging	0.77
IGL02197:Unc80	APN	1	66530065	missense	probably benign	0.39
IGL02198:Unc80	APN	1	66529986	missense	possibly damaging	0.88
IGL02228:Unc80	APN	1	66608428	missense	possibly damaging	0.72
IGL02327:Unc80	APN	1	66641673	missense	probably benign	0.33
IGL02447:Unc80	APN	1	66503544	missense	possibly damaging	0.86
IGL02489:Unc80	APN	1	66525701	missense	probably benign	0.07
IGL02546:Unc80	APN	1	66554953	missense	possibly damaging	0.83
IGL02629:Unc80	APN	1	66483317	missense	possibly damaging	0.46
IGL02631:Unc80	APN	1	66530063	missense	probably damaging	0.98
IGL02839:Unc80	APN	1	66671675	missense	possibly damaging	0.53
IGL02960:Unc80	APN	1	66678058	splice site	probably benign
IGL02974:Unc80	APN	1	66525658	missense	possibly damaging	0.95
IGL03060:Unc80	APN	1	66637010	missense	possibly damaging	0.96
IGL03062:Unc80	APN	1	66509489	missense	probably damaging	0.96
IGL03074:Unc80	APN	1	66671718	splice site	probably benign
IGL03086:Unc80	APN	1	66509474	missense	probably damaging	0.99
IGL03105:Unc80	APN	1	66472099	missense	probably damaging	0.96
IGL03107:Unc80	APN	1	66631454	missense	probably damaging	0.98
IGL03158:Unc80	APN	1	66641674	missense	probably benign	0.33
IGL03220:Unc80	APN	1	66504938	missense	probably damaging	0.99
IGL03271:Unc80	APN	1	66695603	unclassified	probably benign
IGL03332:Unc80	APN	1	66503631	missense	probably damaging	1.00
IGL03347:Unc80	APN	1	66695466	missense	probably damaging	1.00
R0012:Unc80	UTSW	1	66507391	missense	probably damaging	1.00
R0012:Unc80	UTSW	1	66507391	missense	probably damaging	1.00
R0026:Unc80	UTSW	1	66521584	missense	probably benign	0.27
R0055:Unc80	UTSW	1	66506623	splice site	probably benign
R0149:Unc80	UTSW	1	66521601	missense	possibly damaging	0.82
R0325:Unc80	UTSW	1	66510881	missense	probably damaging	1.00
R0329:Unc80	UTSW	1	66674087	missense	possibly damaging	0.96
R0330:Unc80	UTSW	1	66674087	missense	possibly damaging	0.96
R0355:Unc80	UTSW	1	66549856	missense	possibly damaging	0.77
R0412:Unc80	UTSW	1	66550937	splice site	probably benign
R0422:Unc80	UTSW	1	66483338	missense	probably damaging	1.00
R0477:Unc80	UTSW	1	66570001	missense	probably damaging	0.99
R0507:Unc80	UTSW	1	66527893	missense	possibly damaging	0.66
R0513:Unc80	UTSW	1	66622474	missense	possibly damaging	0.73
R0553:Unc80	UTSW	1	66506669	missense	probably damaging	0.97
R0626:Unc80	UTSW	1	66608442	missense	probably benign	0.01
R0655:Unc80	UTSW	1	66503781	missense	probably damaging	0.98
R0742:Unc80	UTSW	1	66527893	missense	possibly damaging	0.66
R0755:Unc80	UTSW	1	66504923	missense	probably damaging	1.00
R0782:Unc80	UTSW	1	66622581	missense	possibly damaging	0.53
R0837:Unc80	UTSW	1	66648944	missense	possibly damaging	0.73
R0841:Unc80	UTSW	1	66472088	missense	probably damaging	1.00
R0893:Unc80	UTSW	1	66521486	missense	probably damaging	0.97
R0900:Unc80	UTSW	1	66671598	missense	probably benign	0.33
R0924:Unc80	UTSW	1	66510641	missense	possibly damaging	0.95
R0930:Unc80	UTSW	1	66510641	missense	possibly damaging	0.95
R0989:Unc80	UTSW	1	66646440	missense	possibly damaging	0.53
R1145:Unc80	UTSW	1	66472088	missense	probably damaging	1.00
R1145:Unc80	UTSW	1	66472088	missense	probably damaging	1.00
R1224:Unc80	UTSW	1	66471980	missense	probably damaging	1.00
R1240:Unc80	UTSW	1	66635902	missense	possibly damaging	0.85
R1245:Unc80	UTSW	1	66555095	missense	possibly damaging	0.94
R1467:Unc80	UTSW	1	66521581	missense	possibly damaging	0.46
R1473:Unc80	UTSW	1	66521581	missense	possibly damaging	0.46
R1500:Unc80	UTSW	1	66521581	missense	possibly damaging	0.46
R1556:Unc80	UTSW	1	66521581	missense	possibly damaging	0.46
R1562:Unc80	UTSW	1	66637957	missense	probably damaging	1.00
R1655:Unc80	UTSW	1	66672756	missense	possibly damaging	0.86
R1674:Unc80	UTSW	1	66509308	missense	probably damaging	1.00
R1680:Unc80	UTSW	1	66503669	nonsense	probably null
R1739:Unc80	UTSW	1	66527892	missense	probably damaging	0.97
R1756:Unc80	UTSW	1	66639248	missense	possibly damaging	0.53
R1783:Unc80	UTSW	1	66683273	missense	probably benign	0.01
R1834:Unc80	UTSW	1	66639248	missense	possibly damaging	0.53
R1854:Unc80	UTSW	1	66631414	missense	possibly damaging	0.93
R1871:Unc80	UTSW	1	66510717	missense	possibly damaging	0.77
R1878:Unc80	UTSW	1	66509402	missense	probably damaging	0.96
R1883:Unc80	UTSW	1	66525770	missense	possibly damaging	0.89
R1912:Unc80	UTSW	1	66510625	missense	probably damaging	1.00
R1990:Unc80	UTSW	1	66692549	missense	probably damaging	0.97
R2007:Unc80	UTSW	1	66503776	missense	probably damaging	1.00
R2035:Unc80	UTSW	1	66606593	missense	probably damaging	0.98
R2056:Unc80	UTSW	1	66640552	missense	possibly damaging	0.72
R2060:Unc80	UTSW	1	66640595	missense	possibly damaging	0.53
R2074:Unc80	UTSW	1	66679744	critical splice donor site	probably null
R2088:Unc80	UTSW	1	66590227	missense	possibly damaging	0.77
R2089:Unc80	UTSW	1	66671715	splice site	probably benign
R2091:Unc80	UTSW	1	66671715	splice site	probably benign
R2139:Unc80	UTSW	1	66521581	missense	possibly damaging	0.46
R2169:Unc80	UTSW	1	66521581	missense	possibly damaging	0.46
R2175:Unc80	UTSW	1	66677355	missense	probably damaging	1.00
R2248:Unc80	UTSW	1	66623206	splice site	probably benign
R2255:Unc80	UTSW	1	66618258	missense	possibly damaging	0.53
R2308:Unc80	UTSW	1	66648997	missense	possibly damaging	0.53
R2484:Unc80	UTSW	1	66521581	missense	possibly damaging	0.46
R2507:Unc80	UTSW	1	66612107	missense	possibly damaging	0.53
R2512:Unc80	UTSW	1	66671608	missense	possibly damaging	0.70
R2878:Unc80	UTSW	1	66671576	critical splice acceptor site	probably benign
R3040:Unc80	UTSW	1	66639305	missense	probably benign	0.33
R3104:Unc80	UTSW	1	66623291	missense	probably benign	0.33
R3402:Unc80	UTSW	1	66510686	missense	probably damaging	0.97
R3403:Unc80	UTSW	1	66510686	missense	probably damaging	0.97
R3413:Unc80	UTSW	1	66639305	missense	probably benign	0.33
R3426:Unc80	UTSW	1	66639305	missense	probably benign	0.33
R3427:Unc80	UTSW	1	66639305	missense	probably benign	0.33
R3428:Unc80	UTSW	1	66639305	missense	probably benign	0.33
R3904:Unc80	UTSW	1	66639296	nonsense	probably null
R3916:Unc80	UTSW	1	66677495	missense	probably benign	0.11
R3950:Unc80	UTSW	1	66622570	missense	possibly damaging	0.53
R4642:Unc80	UTSW	1	66671714	splice site	probably null
R4646:Unc80	UTSW	1	66669235	missense	probably benign	0.03
R4655:Unc80	UTSW	1	66671662	missense	probably benign	0.18
R4662:Unc80	UTSW	1	66646436	missense	probably benign	0.01
R4720:Unc80	UTSW	1	66510792	missense	possibly damaging	0.92
R4736:Unc80	UTSW	1	66649672	critical splice acceptor site	probably null
R4795:Unc80	UTSW	1	66527941	missense	probably damaging	0.97
R4888:Unc80	UTSW	1	66644447	missense	probably damaging	0.98
R4917:Unc80	UTSW	1	66646550	missense	possibly damaging	0.86
R4918:Unc80	UTSW	1	66646550	missense	possibly damaging	0.86
R4983:Unc80	UTSW	1	66674732	splice site	probably null
R5051:Unc80	UTSW	1	66509477	missense	probably damaging	0.96
R5111:Unc80	UTSW	1	66527995	missense	possibly damaging	0.66
R5122:Unc80	UTSW	1	66679590	missense	possibly damaging	0.53
R5260:Unc80	UTSW	1	66646587	missense	possibly damaging	0.53
R5351:Unc80	UTSW	1	66606513	missense	possibly damaging	0.73
R5387:Unc80	UTSW	1	66530021	missense	possibly damaging	0.77
R5437:Unc80	UTSW	1	66654578	missense	possibly damaging	0.96
R5525:Unc80	UTSW	1	66606614	missense	possibly damaging	0.72
R5621:Unc80	UTSW	1	66638043	missense	possibly damaging	0.53
R5690:Unc80	UTSW	1	66640572	missense	probably benign	0.08
R5762:Unc80	UTSW	1	66693796	missense	possibly damaging	0.82
R5956:Unc80	UTSW	1	66527964	missense	probably damaging	0.97
R6005:Unc80	UTSW	1	66627257	missense	possibly damaging	0.53
R6025:Unc80	UTSW	1	66695568	missense	possibly damaging	0.90
R6033:Unc80	UTSW	1	66473260	missense	possibly damaging	0.92
R6033:Unc80	UTSW	1	66473260	missense	possibly damaging	0.92
R6117:Unc80	UTSW	1	66675067	missense	possibly damaging	0.72
R6156:Unc80	UTSW	1	66612250	missense	probably benign	0.01
R6157:Unc80	UTSW	1	66654029	nonsense	probably null
R6189:Unc80	UTSW	1	66677471	missense	probably benign	0.33
R6291:Unc80	UTSW	1	66521597	missense	possibly damaging	0.82
R6367:Unc80	UTSW	1	66672766	missense	probably benign	0.33
R6598:Unc80	UTSW	1	66468540	critical splice donor site	probably null
R6724:Unc80	UTSW	1	66683191	missense	possibly damaging	0.90
R6763:Unc80	UTSW	1	66521477	missense	probably benign	0.00
R6773:Unc80	UTSW	1	66651543	missense	probably benign	0.33
R6883:Unc80	UTSW	1	66646404	missense	probably benign	0.33
R6951:Unc80	UTSW	1	66648511	missense	possibly damaging	0.53
R6965:Unc80	UTSW	1	66646566	missense	probably benign	0.33
R6993:Unc80	UTSW	1	66549793	missense	possibly damaging	0.60
R7041:Unc80	UTSW	1	66503593	missense	probably benign	0.00
R7050:Unc80	UTSW	1	66550908	splice site	probably null
R7067:Unc80	UTSW	1	66646572	missense	possibly damaging	0.86
R7080:Unc80	UTSW	1	66646521	missense	possibly damaging	0.53
R7193:Unc80	UTSW	1	66549784	missense	possibly damaging	0.60
R7197:Unc80	UTSW	1	66521566	nonsense	probably null
R7278:Unc80	UTSW	1	66552209	missense	possibly damaging	0.82
R7290:Unc80	UTSW	1	66601197	missense	probably damaging	0.97
R7391:Unc80	UTSW	1	66695528	missense	probably benign	0.18
R7401:Unc80	UTSW	1	66646415	missense	possibly damaging	0.96
R7470:Unc80	UTSW	1	66622462	missense	probably benign	0.02
R7573:Unc80	UTSW	1	66521537	missense	probably damaging	1.00
R7637:Unc80	UTSW	1	66672684	missense	possibly damaging	0.86
R7678:Unc80	UTSW	1	66649722	missense	probably benign	0.33
R7697:Unc80	UTSW	1	66637945	missense	possibly damaging	0.93
R7746:Unc80	UTSW	1	66677385	missense	probably benign	0.33
R7768:Unc80	UTSW	1	66510595	missense	possibly damaging	0.56
R7855:Unc80	UTSW	1	66483349	missense	possibly damaging	0.78
R7878:Unc80	UTSW	1	66601141	missense	possibly damaging	0.88
R7879:Unc80	UTSW	1	66510707	missense	probably benign	0.00
R8024:Unc80	UTSW	1	66606644	missense	possibly damaging	0.86
R8026:Unc80	UTSW	1	66483304	missense	possibly damaging	0.92
R8115:Unc80	UTSW	1	66648913	missense	probably benign	0.00
R8135:Unc80	UTSW	1	66509287	missense	possibly damaging	0.49
R8170:Unc80	UTSW	1	66651533	missense	probably benign	0.33
R8239:Unc80	UTSW	1	66654019	missense	probably benign
R8249:Unc80	UTSW	1	66619491	missense	probably benign	0.01
R8275:Unc80	UTSW	1	66640614	nonsense	probably null
R8288:Unc80	UTSW	1	66473350	missense	probably benign	0.07
R8341:Unc80	UTSW	1	66649033	missense	possibly damaging	0.73
R8356:Unc80	UTSW	1	66641629	missense	possibly damaging	0.85
R8433:Unc80	UTSW	1	66638028	nonsense	probably null
R8456:Unc80	UTSW	1	66641629	missense	possibly damaging	0.85
R8509:Unc80	UTSW	1	66641629	missense	possibly damaging	0.85
X0019:Unc80	UTSW	1	66648382	missense	probably benign	0.33
X0021:Unc80	UTSW	1	66509266	critical splice acceptor site	probably null
X0024:Unc80	UTSW	1	66491046	missense	probably benign	0.21
X0062:Unc80	UTSW	1	66623259	missense	probably benign	0.02
X0066:Unc80	UTSW	1	66530757	missense	possibly damaging	0.77
Y4335:Unc80	UTSW	1	66521581	missense	possibly damaging	0.46
Y4336:Unc80	UTSW	1	66521581	missense	possibly damaging	0.46
Y4338:Unc80	UTSW	1	66521581	missense	possibly damaging	0.46
Z1088:Unc80	UTSW	1	66646451	missense	possibly damaging	0.85
Z1176:Unc80	UTSW	1	66694409	missense	probably benign
Z1177:Unc80	UTSW	1	66646398	missense	possibly damaging	0.72
Z1177:Unc80	UTSW	1	66695339	missense	probably benign	0.03

Predicted Primers

PCR Primer
(F):5'- TCTCTCTGTCACTGGGATCAGG -3'
(R):5'- AGGGAGCTAGTTACCAACCAAG -3'

Sequencing Primer
(F):5'- GATCAGGGCCTCACTTGTGATAC -3'
(R):5'- GCTAGTTACCAACCAAGTTTTAGGC -3'

Posted On

2019-11-26