Incidental Mutation 'R7796:Dennd1b'
ID600205
Institutional Source Beutler Lab
Gene Symbol Dennd1b
Ensembl Gene ENSMUSG00000056268
Gene NameDENN/MADD domain containing 1B
Synonyms4632404N19Rik, 6820401H01Rik, 4930467M19Rik, F730008N07Rik
MMRRC Submission
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R7796 (G1)
Quality Score225.009
Status Validated
Chromosome1
Chromosomal Location138963435-139178960 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) G to A at 139062873 bp
ZygosityHeterozygous
Amino Acid Change Glutamic Acid to Lysine at position 192 (E192K)
Ref Sequence ENSEMBL: ENSMUSP00000142738 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000094505] [ENSMUST00000168527] [ENSMUST00000198759] [ENSMUST00000200429] [ENSMUST00000200533]
Predicted Effect
SMART Domains Protein: ENSMUSP00000092082
Gene: ENSMUSG00000056268
AA Change: E97K

DomainStartEndE-ValueType
DENN 15 196 1.14e-74 SMART
dDENN 227 293 1.07e-20 SMART
Predicted Effect
SMART Domains Protein: ENSMUSP00000127580
Gene: ENSMUSG00000056268
AA Change: E172K

DomainStartEndE-ValueType
uDENN 9 89 7.86e-28 SMART
DENN 90 271 1.14e-74 SMART
dDENN 302 368 1.07e-20 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000198759
Predicted Effect probably damaging
Transcript: ENSMUST00000200429
AA Change: E172K

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000143783
Gene: ENSMUSG00000056268
AA Change: E172K

DomainStartEndE-ValueType
uDENN 9 89 3.2e-31 SMART
DENN 90 271 4.8e-78 SMART
low complexity region 307 318 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000200533
AA Change: E192K

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000142738
Gene: ENSMUSG00000056268
AA Change: E192K

DomainStartEndE-ValueType
uDENN 9 89 7.86e-28 SMART
DENN 90 232 4.61e-6 SMART
Meta Mutation Damage Score 0.6017 question?
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 100.0%
  • 10x: 99.8%
  • 20x: 99.4%
Validation Efficiency 100% (54/54)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] Clathrin (see MIM 118955)-mediated endocytosis is a major mechanism for internalization of proteins and lipids. Members of the connecdenn family, such as DENND1B, function as guanine nucleotide exchange factors (GEFs) for the early endosomal small GTPase RAB35 (MIM 604199) and bind to clathrin and clathrin adaptor protein-2 (AP2; see MIM 601024). Thus, connecdenns link RAB35 activation with the clathrin machinery (Marat and McPherson, 2010 [PubMed 20154091]).[supplied by OMIM, Nov 2010]
PHENOTYPE: Homozygous KO results in enhanced allergic responses to aerosolized antigen challenges caused by delayed TCR down-modulation following receptor activation in T helper 2 cells. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 57 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
A630089N07Rik T A 16: 98,065,824 I313F probably benign Het
Acot2 T A 12: 83,988,483 probably null Het
Agbl4 G T 4: 110,660,968 G152V unknown Het
Arap2 A G 5: 62,730,762 S414P probably damaging Het
C330021F23Rik T C 8: 3,584,160 V111A probably benign Het
Cep85l A C 10: 53,281,401 N735K probably damaging Het
Col12a1 T C 9: 79,678,551 S1209G possibly damaging Het
Dpf1 C G 7: 29,311,681 N168K possibly damaging Het
Dync1li2 T A 8: 104,430,549 Y184F probably damaging Het
Epb41l2 A G 10: 25,443,829 T187A probably benign Het
Fam50b G A 13: 34,747,101 E187K possibly damaging Het
Fndc3b G A 3: 27,461,743 T638I probably benign Het
Gm11564 A G 11: 99,815,598 V2A unknown Het
Gm13088 T A 4: 143,654,157 D432V possibly damaging Het
Gm3159 A G 14: 4,400,560 *206W probably null Het
Gm32742 A G 9: 51,159,823 probably null Het
Gm4847 G A 1: 166,642,250 H85Y probably damaging Het
Gprc5c A T 11: 114,864,532 D345V probably damaging Het
Kalrn A T 16: 34,187,484 Y1363* probably null Het
Kdm5a T C 6: 120,390,763 V473A probably damaging Het
Kidins220 T C 12: 24,982,351 C28R probably damaging Het
Klhl5 T C 5: 65,164,622 Y664H probably damaging Het
Krt17 A G 11: 100,260,872 S32P probably benign Het
Krt83 A G 15: 101,485,984 V424A possibly damaging Het
Lipo1 T C 19: 33,782,234 T201A possibly damaging Het
Map2 A G 1: 66,416,495 probably null Het
Megf10 C A 18: 57,277,659 T680N possibly damaging Het
Metap1d T A 2: 71,512,162 D178E probably damaging Het
Miip C T 4: 147,862,918 G236S probably benign Het
Mki67 A G 7: 135,698,194 S1704P probably damaging Het
Nr2f2 A G 7: 70,358,153 S194P probably benign Het
Nrsn2 T A 2: 152,376,551 probably benign Het
Ociad1 C T 5: 73,294,947 P27L probably damaging Het
Olfr1238 T A 2: 89,406,813 T89S possibly damaging Het
Olfr1339 T A 4: 118,734,685 I52N probably damaging Het
Patj A T 4: 98,546,983 M1L probably benign Het
Pcdhb2 A G 18: 37,295,393 I140V possibly damaging Het
Pla2g6 T C 15: 79,317,825 N49D probably benign Het
Pxdc1 T A 13: 34,652,371 N22I probably damaging Het
Rpgrip1l A G 8: 91,270,237 Y672H probably damaging Het
Safb2 T C 17: 56,566,327 R779G possibly damaging Het
Skiv2l C T 17: 34,844,418 G628S probably damaging Het
Smg5 A T 3: 88,349,432 Q299L probably damaging Het
Sptbn2 C G 19: 4,749,012 R2037G probably benign Het
Sulf1 T C 1: 12,858,820 L864S probably benign Het
Tas1r1 A G 4: 152,034,755 V119A probably benign Het
Tasp1 T C 2: 140,008,785 N106S probably damaging Het
Tcf4 T A 18: 69,564,069 N156K probably benign Het
Trav14n-3 T A 14: 53,370,370 Y52* probably null Het
Ttn T C 2: 76,834,878 E11598G unknown Het
Unc80 A G 1: 66,503,714 I376V probably benign Het
Ybx3 T C 6: 131,368,516 E298G probably damaging Het
Yipf7 T C 5: 69,527,253 Y73C possibly damaging Het
Zdbf2 G A 1: 63,303,424 A321T possibly damaging Het
Zfp369 A G 13: 65,296,215 R391G probably benign Het
Zfp54 A G 17: 21,434,720 E492G probably damaging Het
Zfp971 A G 2: 178,031,610 T51A probably benign Het
Other mutations in Dennd1b
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00417:Dennd1b APN 1 139062940 missense probably damaging 1.00
IGL00510:Dennd1b APN 1 139102071 missense probably damaging 1.00
IGL00671:Dennd1b APN 1 139133737 missense possibly damaging 0.94
IGL00937:Dennd1b APN 1 139170239 missense probably benign 0.01
IGL00959:Dennd1b APN 1 139143888 splice site probably benign
IGL01446:Dennd1b APN 1 139023110 missense possibly damaging 0.61
IGL01610:Dennd1b APN 1 139169766 utr 3 prime probably benign
IGL02275:Dennd1b APN 1 139081254 missense probably damaging 1.00
IGL02851:Dennd1b APN 1 139168967 utr 3 prime probably benign
IGL02995:Dennd1b APN 1 139081242 missense probably damaging 1.00
IGL03089:Dennd1b APN 1 139102029 missense possibly damaging 0.94
IGL03240:Dennd1b APN 1 139139392 missense possibly damaging 0.63
IGL03267:Dennd1b APN 1 139062861 nonsense probably null
Dendrite UTSW 1 139053417 critical splice donor site probably null
LCD18:Dennd1b UTSW 1 139114764 intron probably benign
PIT4418001:Dennd1b UTSW 1 139081261 missense
PIT4504001:Dennd1b UTSW 1 139040004 missense probably benign 0.28
R0426:Dennd1b UTSW 1 139170196 missense probably benign
R0445:Dennd1b UTSW 1 139167765 splice site probably benign
R0497:Dennd1b UTSW 1 139039986 splice site probably benign
R0627:Dennd1b UTSW 1 139081219 missense probably damaging 1.00
R1027:Dennd1b UTSW 1 139041962 missense probably damaging 1.00
R1599:Dennd1b UTSW 1 139167730 missense probably benign 0.01
R1703:Dennd1b UTSW 1 139169754 critical splice acceptor site probably null
R1844:Dennd1b UTSW 1 139090405 splice site probably null
R1943:Dennd1b UTSW 1 139168952 utr 3 prime probably benign
R2504:Dennd1b UTSW 1 139170170 utr 3 prime probably benign
R2866:Dennd1b UTSW 1 139170281 missense possibly damaging 0.58
R3109:Dennd1b UTSW 1 139041916 splice site probably benign
R3843:Dennd1b UTSW 1 139053354 missense probably damaging 1.00
R3926:Dennd1b UTSW 1 139143959 missense probably benign 0.00
R4258:Dennd1b UTSW 1 139062940 missense probably damaging 1.00
R4504:Dennd1b UTSW 1 139085927 missense possibly damaging 0.82
R4805:Dennd1b UTSW 1 139053384 missense probably damaging 1.00
R4922:Dennd1b UTSW 1 139085914 missense probably damaging 0.99
R4954:Dennd1b UTSW 1 139053386 missense probably damaging 1.00
R5098:Dennd1b UTSW 1 139133721 missense probably damaging 0.97
R5205:Dennd1b UTSW 1 139054568 missense probably benign 0.00
R5240:Dennd1b UTSW 1 139062877 missense probably damaging 1.00
R5383:Dennd1b UTSW 1 139167671 missense probably benign
R5504:Dennd1b UTSW 1 139090508 missense probably benign 0.07
R5702:Dennd1b UTSW 1 139133675 missense probably damaging 1.00
R5801:Dennd1b UTSW 1 139039989 splice site probably null
R6144:Dennd1b UTSW 1 139081255 missense probably damaging 1.00
R6190:Dennd1b UTSW 1 139133675 missense probably damaging 1.00
R6192:Dennd1b UTSW 1 139167718 missense probably benign 0.00
R6289:Dennd1b UTSW 1 139168945 utr 3 prime probably benign
R6453:Dennd1b UTSW 1 139143948 missense probably benign 0.07
R6479:Dennd1b UTSW 1 139041960 intron probably benign
R6940:Dennd1b UTSW 1 139053417 critical splice donor site probably null
R6954:Dennd1b UTSW 1 139168945 utr 3 prime probably benign
R7183:Dennd1b UTSW 1 139170252 missense unknown
R7710:Dennd1b UTSW 1 139062932 missense probably damaging 1.00
R7742:Dennd1b UTSW 1 139062873 missense probably damaging 1.00
R7871:Dennd1b UTSW 1 139062873 missense probably damaging 1.00
R7920:Dennd1b UTSW 1 139062873 missense probably damaging 1.00
R7921:Dennd1b UTSW 1 139062873 missense probably damaging 1.00
R7991:Dennd1b UTSW 1 139085896 missense
R8025:Dennd1b UTSW 1 139110420 missense
R8239:Dennd1b UTSW 1 139041935 missense probably benign 0.02
R8526:Dennd1b UTSW 1 139023120 nonsense probably null
R8532:Dennd1b UTSW 1 139170174 utr 3 prime probably benign
RF008:Dennd1b UTSW 1 139053397 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- CTTCTCCATTGGGTACAAAAGATGG -3'
(R):5'- AATGTGCAGACGTGTTTAGGTC -3'

Sequencing Primer
(F):5'- AGATGGTATTATTAGAAGTGGCATTC -3'
(R):5'- GGTCTTTTTGTGAAGCACTCAATATG -3'
Posted On2019-11-26